Description :
From Genome Similarity Track
Location :
Scaffold_25:120175- 122754
Transcript NameFunction/comments
Albla_Nc14029110
Albla_Nc14029120

Sequence
2579 bases(100 bases per row)
ACCGGATGCCCACACTACGTTGCAGATAAGTTTAATCAATTTTATGGCATTTCTGACTTTAACAAAACCTCGCGCAAGAGAGGATTTGCCCGCTCTCGAG
ATTTGAGTGACAGAAAAGGAATCACCCGTGGTATGAAAGCCCTTGGACTTACTTGTAGATGACACATCCAAGCACTACAAGCTGCCTGACCGATGAACAA
TAATTGTAAATCCTTTGATGCTTAACCTCTTTAATAGTAGAAAATACTGGAGTGAAATAATACAGAATGACATTCAATGACATAAACGTGGGCGGAAGTA
CCTAGCGTCTGATGTTTCAATGACCATACCGAAGCTCAATTGAAGGTGTCTATATTACTAGAATTAGACTAATTGACTTCTCTAAATGTCTAGGCTAGCG
TAAACAATAAATGGAAGCCGCTAAGGCCACAGTTCAAACTACTACGGCCACAGTCCAAAAGTACTACGGCCACAGTCTAAAAGTACTGTACATAGGGTCA
CTAATATAATCGTTAATGTAAGATCAAGTGTAAACCTTTGCCTGAGCAGTTACCAATATGCATGCTGGTGGCATGAACGTTGAGAAAAATATAAACACTG
AAGCCGCTATTGTTACTAATTCCTCGTACAAGCTACGAGATGGAGAACACGTTGTTCATTACAAATTTGATCGTGAAGGCGTAGATTAAGATCTCCACGG
GATTTCAAAAGATACAAGATTGCGGAAGGGTAAAGACAGCGTTCTTGTCGATTGTCCTTTCAGAGGAGTCAGAGACAAGTTGAGTATATCTCTAGCAACA
CTGATCCTTACAATTAGACTATCAATTTAAACCTTATCTAAGTTCTAACCCTTATCTTAGTTTCAACCCTAAACCGTGACCCCGTGGCCAATATGTGATC
TTAGAAGACTCATACAGTACTTTTAGACTGTGGCCGTAGTAGTTTTGGACTGTTGCCGTAGTAGTTTGGACTGTGGCCATAGCGGCTTCCGTAATAAATA
TGGATACAAATATTTACAGGAAGATACCTTCAGAGTTGACAATATGTCTTGCGGTTGACGTTCCTCTATTGAGGTACCTTACTGCTCCTCAATAGGAGCT
GGTGGCCAGCGTGAAATAAAATGTAAAATGGCCAACAGTTAACGTGACCTTACAATGATGTCCGATACTAAGTTGAGTGTAGTCATTCAGCCAAATCCAG
GATCATGGCTGCACTTGCCGTTGCCCTACTCGTAGTAAGGAAGCTCGAGTGCGGAGAAAAGCACCAAACGAACTTTGCTTTGATAGTTGATCCAGCACCT
TTGCCAGCTGAATACGATCGTCTTCGTCGTAACACTGCCGTCGAAAGTACCGAACAAACGTTGTGTAGATCACGGATAGTGCAGGAGTTGTCGGAGTTGG
TGATCGGTTATCAAACAATACGCGATTTCGATCGCTCCAGTTGAAGTGCAGCGTCACTGGCTGTAGTGCTAGCCACAAGTCGGACAAAATCTGCTGATAT
TCCTTCCACTCCGTCCGTACCGGAGGCACAATTGCACATGCAATGTTCGTCCAACGCGGTCGGGAAGAAAAAACTTGATCCCATGTCGGGAGAAGCTCCA
ACCATAACTGAGCTGTGCGGTTGCAATCGAAAAAGAGATGTTAATCTGATTCGACTGCTCCACACGAAGGATGAATGCACAATATAATGTTGCGCTGCAT
GTCTTTCAAGAACCAGTACCGGGATCGAACTGGCAGCATCCGAAAGGCTAGACGAAATTGTCAATCCTCAAAAATTGGTAGAACACGCTTTCGAAGATGT
CTCGAAGTATCTGTGAATGTTCGAACCCTATCCGTATCTGTAGTTTTGGATCGCTCTCGAGATGACCAATGTGTCAACAACGGGTGGCTCCTGGTTGCTC
CGGGAGGTTTTCAAACAAGTCGTGAGAGAAGTGATCGTGAAATAGATGGACAAACCCACTGCTTCTCCTTGATGCGCACTCCCACTGGAAACAGTCGTAC
ACTTGTGCTGGGTGGAATCCAAGTGATGAGACGAATAGTTGAATAAATACGCTGGAGAAGCTGGGTGACTTCTTCATAAAGTCGTCCCAGCAATTTTTCT
TCAGCTATATCCGATGGATTGAGCTTTTCGTCGTTGTAATATTTGTTGACAAAAGCTTGCTTCTTAAGCCATGTGTCGCAGTCTCGGAATAAATCTTGGA
GGCTTTGGATACCAAACACTTGAGCAAATATTTTCCGAAACATGCGATGAGACTCATCCACCATGCCAAGATTGTAGCAAACGTTTTTTGTACGAGGATT
CCGAGTAGCATTCATAATGCAGTACTGGGTTGCAATGAACCCAGACTGGTTGTTGCATATAGTACTGACGTCGCTGTAGCACATTCAGATTTGAGATTAT
GATACTCCAATCGATCTGATGCCACATTTTAAATGCGTTTTTGTTGGAAAGTACCGACTCCACATTGCCATCCGCCGGACGTTTTGGTAAAAAGATTCAA
GGATCTAAACAGTGGTTTCGTATACCTTCCGCTATGGACTGTCCCGACGCGGTGGTTTCGTAACCAAGGAAGGCCATAG