Description :
From Genome Similarity Track
Location :
Scaffold_65:120171- 127936
Transcript NameFunction/comments
Phyca_LT1534126960secreted RxLR effector peptide protein, putative
Phyca_LT153462671GAF sensor protein
Phyca_LT1534554820protein kinase, putative
Phyca_LT1534126856ATP-dependent DNA helicase

Sequence
7765 bases(100 bases per row)
tgaaaaaaggttgtccacccgctatgggaaattcccattgacaatgtgatattttcttcaaaacttttcaaaaagtcagagtaagcttagtacggtaggc
aaaaaactgtcctggataaatcctggtcaatgaccatttttatggatatccaggatgaacgtggcgataaatgtcacacgactacatgtaacaatcgtac
atgtacagacgtcccccggggacgtctgtacatgtacgattggggactccccgccttgcgtagaactgaatgcagcgataaacctacgagagatggtacc
agcgtgcaatgcagatttgcttggcttcccgcacatgtactgagttagaggataattctataggaaaagtgtcgcttgcgggaagcatgcatgcatgcat
cggttgctagttggataaactcagtacatgttgcatctatgccagacctgtgcgaatcgcgtggcctgccagtctttattggtcccacctttctacccaa
ggcggggacgtctgtacatgtatttaataaatctggtcattttcagtacaaccgcggcgtcgacgcacaagaattgacatgctgtctagcgttgtgtaag
cggagatcttaaggaacgacgggtaaggcgtcggaggagcggaaggagctaaagaagaaggaggcggcggccgagctaacgacgactgccaaaacgataa
atactacaggtagtactacaactttaatacctcacgtacactgaaaatcttacataactctaaagttcaagacgactggcacgcgccacgcaggattcaa
attaagatggtgtaccagctgcaaattttgctattcgaggacctcagcggctgggccagccaccgctagtcgaatatgggtctcagtttgcaatttgccg
taaggagcctgcttcaagagattcaagaaatgcgtatcccctgctccctgctcgtggtaatcattgccctcctgtctactactaccaacgcgatttcaac
agaagcggatgctgggaggagatcccttcgatcaatgaaggcaaaggtccaagacaaccaagtggaagaggaacgtggtggtaccggtactagttccctt
aaggcctttgttcacgatttcgacttcaatcttctcgacaacattttcctgccggcagacttcaagaggatgacaaaggagcctgaattcctcagacata
tgatggcctcgtggcaaatgggcttcatgtcagttgacgacattgttctttacatgacgcgactcaacatgagcgaaaaggcgatcaatcagtttaagct
tgcgtacacggcgtatcttgaatatctgaaagcggtcgccaaggctgagaaggcagcaaaacttgctaaagcttcattaaactaaggattttcccattat
ctatactgtatactacttctagaagtagtattcattttgttcttcttctgtgtgggttgtgcagaactcaatggcgccaggccagtcatccgtcggttta
gcaacgtgatgactggcgaacgacctcacgaaacaccgaaacggagatacggggtaacacgccagattgtaaaaggcagcgaaaccagttgagtaggaca
ctggtggtcgtctccactgctacacatgacgcgggtggcgtaaccaccgctgcaacagagttaaacagtgccgttcgacagaatctactcgctctaagtt
cccagcttccgaataggcatcgtacagctctccagcttcgagtcaaatcaaaataattcgtttgagcaggagatcctgatgactggcgagtaatggtctt
acaagatgccaccgaaactccagcaaagcagctcagaatctccactgcccagtggtccatcgaaaaaggtgtgacttgccgatgcctcgtcgctttcgag
ttcgtgcaacaaccagttattcttcaaaagcggtcaggctgaggcatcaagccagcaagagcgccaggcatccggtgctgtcgacaccttccctgcttga
ccattctgttgagctcctggatggctgcgccaacattgcgctgtgcggctttggcgtcctcactcctcaatttgcagtgacccaagcatccaccaaccag
tcttgatgacggacagctacatcggtagcagttgccgaggcagtatccgaagcagcgacttccagagcagcaacaacagtgccgcttcacccgtgtccgc
acgtaacgctctattatccgcgtcatctatcaacgcaatcgtgaccgaccgggagctgttcgtcacagcagcgagcgtcattccaaagctccgatcggtg
atggaatatcgcaaagatacttctcgaagcagcatccgaagaatgacatcctcaaccagtcagcaagcgccacactgggtcgtcaagaagcagcagcatg
gggctgtaatcagcgaattcgatcgcgccaagctgccatcgaccaaaagtgaagctccgacttggtttcgcggtaacactcgagtcactgatgttcgtca
ttcaatggtcgatcctcgtggctccatctacactcgcgatgcttttcatggggagcagcacacacagtctgaagtgcgagcacgagagctgttgcaatgg
ccacggaatgacagcaacgtcatctatgcggtatccgcccaagtaacgctgacctgcagactggatgaggctatgacaatgctatttagccgcgactccc
tgcaatttgattccagcatgggcgcgctctttggtgccaggaaatacaaaagcggtgatctgttagtgtcgcgtgagttccgaaagaatctacacactgt
gctgtcgatggaccactccgcctgctgggaagacgacgatctcaacgatctctcgcagtctggttgggttgcactgcaatccgtggttctgcgttctcgt
cggtcgctgaatcccttagcagcagcgagaaacacaagccgtcgacagagactttgctttgctgcgtactcgcaatactgccccgacacgaacgaagctt
tctacaccatgaagactttacccaaacccatgcacgacaaattcactcgccgcaggaacgaacgagctaccaatcaggcgattcaaggcgatatggagca
tatctccgctgggtaccacctagcgagttcatacagcagcttgagcggacaccagactcgaattgtcatgactgcgtacgtcaccagcccatcagcccca
gtatcgaacgtacatcaagctcgttcgagattctgggggaaagaaccttccggttcttctcgacactacgcgccacaaagcgccaatgtcgaggccaagt
acgtggtcaacttactggccgctgcaacgacgtcatttgaacagctcgttcgccgtcgtcgactgggataccagccagttttgcacatgcccttgagcga
tcaggacaacagatgcgcagtgtgtcttaaagctttcgggttgctccgttcgcaacgattctgccagctctgcgctaacggagtctgtcgcgagtgctcg
cggaagtttgcggtggagcccgtggcgcacaaagtgcgtcgcaatcgaatctgtttcgcctgtgtagctcacgtggacgccagtgtgttccaacaagatg
acccacttccacactcttcgttccacagaggttcaactgcaggaacagccactactgtggacgctcgacaggtcgaagatgctgcaaacacgaagatttc
caccgccttctacgacattttgctcaaatccgacgatacggtacgcttttctcaatcaaccgatgcccgaacagcgtcacaagttgcatacgacgcacaa
atgcaccgattagatcgtagcagcagcgcggctaccgcgccaacgtcgttctcctcgacgcccggccgacaattagccgatgcgctgttttcaagcgacc
cattaacccgagcacgggcattggagattgtacgtcaagtggtcaagcaagtgacatccaattcagctccaacgagttcaacttcgacgtcgtcttcaac
gtctgcatcatcgattccagtatttcactcacagtatccggacaagaggatggtcgacaagtacttagaggcacgtctccatttgtcgagcatttcgaag
agcagcgatttcaacagagaaactccacgcacttcggcatacacccgtcaggacgtgacacaacgtcgtcgacgcagcaccagcggcaagtgcttcccgt
cttcagcgaaccccaacacaagaccttccgtcgtctctcgaccatggacaacgacgaacctagaggtggaattggatctagacgacgacttggactccgt
cgctttggactccatctgtgaggttgctgccggccgaatgcgatgctccaccgcgtacattgtggctttcaacggttcccacagttttcactctcagcga
gtcgtaggctctttcggtgctccacgttcatggactgatgaggtgacggtgtgtccgttctctctagtggctaacggcaaaccgttcgtggtcaaagacc
ccacgcgaaactctcaactgcggcatttacctcttgtgcgcgacatcggcgtgcgcttcttcgccggattccccatcaaatcgcccgacggttcagtcgt
tgcctgcctgtgcactctagacgtcaagactcgagagaaaatctcactggaagatctcagggccatgcacgcgctgtccaagctcgcgtcggatctcttc
gaggaggaggttaacccatacacacctcgttaagtctcttcaacttgtttcagttaaatgttacaattttagcttcaatactgaaatccagttccaatta
ttcttcaccttaagaccatgcggatgcgtctgttaaggcgcttaacgcgcgcaccaaaggcagcaccgaaggcaacagtacaacctacacctgtactgaa
gtcaaaagagacgtcgtacagcaatgggacgggctgggtggggttcgtaacgacagctgcggcgttaagtgtcgtgtaccttatgcatcgagatgctcca
agcagcgacgtcgagtgtgggtcaagcgatggctcgtggtggaagaacgctaaaattgaccaacgaggccagtacgctttactgaaggagctcggcagag
gaggttcgaaggattgatgctagtggaaaattgaaggatttctaaaacgtttctttgaaattatttaaaaaggtttctcagttgttcgtcttgcagttga
tatgaagaccgacgaggtgagagaccccagtagttgtaggagagtttaagggcttacatttgtcgtttttttcgctaaaagatgttggcagcgaagattt
tcgacccgaaatgcgcttcgacggaagcgattcaggctgaggtttgttgcgttggtttctgtagttgttgggagcttacgagctaagacacggactgttt
ttttttggtacagattgatatcctacggcacctgggctcacaacgaaatattgtgtcactgcatgatgtgctgtatctgaagaatgaaaccatcatgctg
acggacttggtcgaaggaggagaactcttcgactatattgtcgacatggtgagcgtgcaatttaggcttgtccgcgggtatttggtgcttaaacggcttt
aaatttccattttcagggatcagtatcggagcaagatgcagctcacctcctgcacgatgtttgtcagggacttgcctacgtgcactcgcgaggggtctgg
taagtttcatattttaaagatgacgtcgtagacatttcacgtttactgtatctgcagtcatcgcgacctaaaacctgaaaatgttttactgtcagaccgg
tccgccaaggcaaacgtgaaagtagcggtgagttggaattatttaagctgccatgttgataaggtattaacttgccgatttgattcaacgccaggatttt
gggctgagtcggcggcagcgacaaggagagcagattattgaaaaatttccgaatgggacagtgttagttgatttagcagatttccacttacacaacgctc
ttgttgattaatgtggtgtttgtttactgttagagcgtactgggcccctgaaatcattacacgccatcctcaggacttcagcgttgatatgtgggcattt
ggtgttttggtatgtaaatggctaccgttctgcctccgttctacatgtacatgcagttgctggaatactgacccagttgctcgttttttttcttaggcct
atatcacgctgacaggggtgcatccatttgacccacgaggcgataagtctgacgctgagattgtgaaggagatcgcgactggaagttacgacggtaagtt
ccattcgcatttatgtacttcagtgcagtatttgagtttttgtactgattcatcgtacagtggagaacaaatggtacaagagcctatctgcagatgcaaa
ggactttttgacgcaactgcttgactcggatccatccaagcgcttgactgccacgcaagcgatgctccatccatggctcagtggtctcaagacgtcagtg
gagccatttgatagcggacacactcaacgacttcatcataccagcgtctgcagcaactacgagccaacattttggctgtcgtcatgggcgttcaacacgc
taaactcggtaaaaactctgtcgctgacgaacggcgcctcacgtccaaacgcacgtcgactgtgaatatggatatgttcaaggaaacgttcgctctgttt
gacaaagatgaatctggttgtatcgatcggaaggagctcaaggacatgctgctggctctggggcagcagctttcaaggtttgcttggccttgttttcttt
ctcttttcgggaggattaactgacgaaacgttgctcacagttccgagattgacgagatcatgcggcaagccgacgttgatggtgatgggaaaatttcatt
caccgagttcgttagcatgatgaaccaacggttattccgtcggtatggattaccttttgctaatgcttactacatgtagtattcgtttgggtaaatgaca
tttacgctgtttatatgtaggggagacctgacgactggcgatctcaaagccgctttcgatgtacgtcatctcactgtgtgggtaaatatggtcgtgattt
cctcttatgcaatttgtttgtcagactttcgatgtcaaccacgacggattcatcacaagtgctgaactcgagcacattctccatgtgctcggcaacaaac
acatcagtaacgaggaaacctgcaagatcatccaagcagccgataagaacgaggacggaaagattgactacgaggaattctgcactttgatgcagcagca
aacacacgttgatggaaacacagctagggaggatgactaacaccaagaagtgcggttgcaggaaatacgacagcgtagggaatcaaaataccggcgtggg
tgacaattacacgtatcgcgctgtcgtaggcggaccaagcgagttgaagtaaatgtaatcggtcggaataacaatgaattgagtttgtctaagaaggtct
agtgactgtggaggcgtttgctacagactttgctactggatctgttagttttccgcacctccatcagcttgagctggctcggtctgttttcgcacatttg
gtttcgagacagctaccaaatgtcaccgagcacgtatggctcgtcaggggcaatgagatgcccacgcggtgctgttcgtgacgacgtggatccgatactt
cgccgccgccatgcgatagtagccatatgctgcgctacagtgaggtcgttcgttttcgcacagtt