Description :
From Genome Similarity Track
Location :
Scaffold_15:120159- 147562
Transcript NameFunction/comments
Phypa_INRA-310PPTG_08016hypothetical protein
Phypa_INRA-310PPTG_08017NPP1-like protein
Phypa_INRA-310PPTG_08018hypothetical protein
Phypa_INRA-310PPTG_08019hypothetical protein
Phypa_INRA-310PPTG_08020pectinesterase
Phypa_INRA-310PPTG_08021hypothetical protein
Phypa_INRA-310PPTG_08022hypothetical protein
Phypa_INRA-310PPTG_08023hypothetical protein
Phypa_INRA-310PPTG_08024hypothetical protein
Phypa_INRA-310PPTG_08025hypothetical protein
Phypa_INRA-310PPTG_08026hypothetical protein
Phypa_INRA-310PPTG_08027hypothetical protein

Sequence
27403 bases(100 bases per row)
TAGTGGCACCAAGGCGGTGTTGCAGTGTCTGCTGGCGGCGTTGGAGGTGTTCACGGACAAGATTCCACAGTTCCTGGGACCGTATCTGCCTGCTGTCATT
CGTGCTCTGTTGACTCCATCCCTGCTCTCTTCTGCACCTGGTAACGCTGAAGTGCTGATGTCCGTGGACTGCTGCTTCTTGAATCTGTGCAACCACGTCG
AACTGCGTCAGCTGCTCCCCACTTTGTTCGGAGCGTACGAGCACGTGTTGACGCTCAAGAGCGACACGAGTGTGACGCGGTTGTTCTCGGTTGTGGGAAC
TGTCGTGAATGATCTTGAATCGTCGGCTATTCGCAAGCATCTGCCTTCGTTTGCTCGCTTCTTCGTTACGGCTTTGGACGCTCGTCGTGTGCATGCGTCC
AAGTTGCAAGACCTGGAGGAAGTGGAGGAAGAAGTGCTGGAATGCCTCGTGCAGTTTATCTTGAAACTGAGCGAGAAGCAGCTTAAGCCGCTGTTTTTGA
AACTGGCGGAGTGGGCGCAGACGCGTGTTGGATCTTCTGGAAAGAGTGGCGACATCTCGCGTCGGATTTCGTTCTCCAAGTTGATTGTTAAGCTTTCGGA
GCGTCTGCGTGGCATCTTCGTGCCGTACTACGCCCACGTTCTGGAGTTCCTGACATCTGCACTTCGTGAGAGTCGCAAGGTGCTGATGCAGAAGCCGCCG
CGGTCTTCGGAAGACAGCGACAGCGACGACGACGACTTCTTTGCTAACGAGGACGAACCGCCTGCCAAGAAGGCGAAACTGGGTGTTTCGTCTACAGTTG
ATGTAAAGATCGAGCGCGAGAGGAATACCCAGCTGTTGACCACCGTGGTGCGCGCTCTGGACGGCTGCTTCGTGCACGATAACGACGGATTTATGGAGAA
GGACCGGTTCGACGTTGTGCTGACACCGCTGGTGGACGTGCTGGACGTGCTGCAGTACGATGCGTCGATGCGCGAGTTCGTGTTGGAGACTGTGGCGCCG
TGTCTGGCGAACTTGGCGTGGGCTGCTAAGAGTGACTTGCTGTGGAAGCCGCTACACTACTCGGTGCTGATGAAGTCGCGTGGAGACAACGCGTTGGTGC
GTCTCGCGGCGCTGGTGACAGTGGAGAAGTGCTATCAGGTGATTGGAGACGAGTTCCTGGCCATGCTGCCTGAGAGTATCCCGTTCCTGGCTGAGCTCAT
GGAGGACACGAACGATGAGGTGGAGAAGACGTGCCACCGTGTGATCAAGCAGATCGAGGACATCTCGGGCGAGTCCTTGGACCAGTACCTCACGACCTAG
ACTACGTCAAGTGCTAGGTAATAGATAGAATAGCCACACACTATGTAGACCTCGCCTCGCACCTCGTACGCTCTTCTCCGAGGTCTGCCCGCCACAGCGA
GGACGTTTTTGCATTTTCATAAGTCGTAATAAGATGTAGATGATACACTTCAGTGTACTAGCGCATGATTGTCGATCTACATGAAATAACACTCCTACTA
ATGAAAGGATTTCAAGACCATGATCGAACCATCACTTGGTGCGGTCGAGTTTTTGCTGCCCGCCCAGCATTGCTGGCTCAGCAATCATTGCTGCAATGCT
ATTTGATGGTACATTTCGTATTGTTTGTGTCAGGAACGACACTCACTATGGTGGTCGTAGCAAATTTGGTCACCACAGCTGTACGTGAGATGCAAGACTT
TCCAATGCCGTGCATGTATAATTCATGTATGTACTGTATCACTTTACATGTATTGGCGTAAGCAAAGCTACCGGCTCAGATTACGACATATCGTCATTAG
ACGATGTGTTGACCGCTTTTTCCAATCATACCGGAATTTTGTTGGCGAATACATGTACATAAATGTCGAGAAGAGAAGAAAGGAAGTCTATTCAACTACT
AGTATGTTAGTTAATGTACATACATGAACGTCAGTAAGGAAAGCATGTACTGTCGGGACAACAAATTGTTGCCAACAATCGTGCTTACTGTCGAGATTCT
TGGACCAAGAGGTTGATGGAGCAACTGTTCCCATCCGAGAAGAGCTCAAGGAGAGCAAAACGTGCGAAAATGACCACAGTACCGTGTTGATTTCCACCTT
CTTCGTTTCTCGAAAGCCAGTTGGCGAAAGCCCCTAGAACACCGTGCTAAGCTCTTCGTGTCAACGTAGCTGATCACTTTTCAATCACCGCGTTGGTACT
CAAGCTCAAGGACTCTCTGTGTTTTGCTAATGAAAGTCAGCGTACTTGTCGGTATCGTCGTTGCTTGCATCGTCACGACTCAAGCCCAGGAGCTTCAGGC
GGAGGAATCTGCATCTTTGGACGAAATACAGAGGGAAGAGCAGCAGCAGCAGCAACAACAACTAGTATCGTTATCAGCATCGACTTCTGAAGATGCCAGT
GGCTCTGTATCCGGCCAAATCGACCTGTTCGACTCTACCTCGGCCTCCGCGAGTGCAAGCACCAGCGGTTCGTGGGATGATGCTATCGTCGGCGATTCCG
CTTCAACTTCGGCGTCGGATGCGTCTGCGACCACCGAGGAGAGCGGTAGCTCGTCGGAAGCACCAAGTGTATCTTCATCGGCGTCAGATACTTCCTCTGT
GTCTTCAGATAGTGGCGATATCACCCAGGAAAGCTTGATCGACTCCTCGGAATCGCTGGAAGCAAGTGCTGCTACTAGCACCAACGTGTCCTCAGACGGT
AGCGACTTCGAGTCCAATGCGGCCTCAGCGGAGAGCGGCAGTGCATCGGAAGCCTCTGCTGCATCGTCGACTACTTCGTCATCTACAACTTCATCTTCCG
ATGATGGTAGTGGCTCTACGGCATCGGGTAGCGGCAACATAAACCAGAGCGACCTGTTTAACTCTACGTCCGGATCGCAGGATTCCACCGCAGCAACGAA
AACCCCTGAACCTTCTATCTCCGTCGAGGATTCCGTTCAGCTAAGCGAAAGCTTCGGTGGCCCACACGGAACGGAGTTTTCGGACGAAGCGGTAGCAACT
TCAGGGCAAACCGTTGTGTCCATTACGATCCGAGCAGGTAAGCGCATCGATGGCGTCGCGTTGGAGATTACAGCGCCTGTGGCGACAATATTCAACCACG
GTGGAGGTGGCGGTGACCCGAAGACTCTCACACTTGGTCCAGGTGAATACATTACGTCGATGGAGGCTCATTGGGGAAAGCGAAATGGTCACACTCGCAT
CTTCTACTTGCGCTTTGGTACGAACGCGGGTAACTTCCTTGAAGGGGGATCCAAGACCGACAGTAAAGCCACGGTGACTGCCCCAGAGGGTTTCCAGCTT
GGAGGATTCTTCGGTCGAGACGGTGACGAGATCGATCTGCTGGGTGCGATTTGGACGAGCATTGCAGTGGTCACACCAGCACCCGGAGCACCGACACCAG
CGCCGACACCGTGGGTAGAAAAGAAGATTGGTCACGATGAAGTGGTGCCTTTTAAGCAACCGGAGCCTGTCACGATCGCTGAAAAAGCTGCCATCAAGTT
TAAACCGCAGCTTCACATCACCAATGGTTGTCACGCGTACCCTGCAGTGAACGTAGGGGGTCAGACTAGTGGGGGTCTCAAGACGACTGGTGCCCCTAGC
GCCGGTTGCAAGGGATCTGGATGGGGGTCTCAGGTTTACGGCCGCTCAACTTGGCACAATGGAGTCTGGGCTATCATGTACAGTTGGTATTTTCCGAAGG
ACTCTCCATCCACTGGTCTGGGTCACCGTCACGACTGGGAACACGTGATCGTGTGGATTGACAATCCCGAGATCGCCGAGCCGAAGATCCTAGCAGTCAC
CCCGTCAGCACACAGTGGGTATTCTGCTCAAGTCCCTCCTGATGCCAATAAGGTTGATGGCAACAGCGTCAAGGTCAAGTACTTGAGCAAATGGCCGATC
AACCACGCTCTGGAAAGCACGGGCGAGGCTGGTGACTACCAGGATCTCATTATGTGGGAGCAGTTGACCGACGCAGCTCGGTTGGCATTGCAAAACACTG
GCTTTGGCAAAGCAAATGTGCCGATGAAGGACGGGAACTTTGTCAGCAAGCTCGACAAGGCCTGGCCGTTTAAAAACTAAGCGGATACATGGAAGTGCAT
CGTAGTGTGATTCGCACACTTCTAGGGGCCTCGTTTTTTTTTAAAGCACTCTAAATGTAGGAAAAAATGGCTTTCCAACAAAACAAAAGAACCGTACGAA
AACGCAACTGATAACTTATCTAAATTATCAATTATCAGTTGCGTTTTGCATTTTTGTAAAAAAAAATTAACGACGCTTTCAATAAAACGGTGCAATCCAA
GTATAAGTTGTTGCACCAAGTAATGCATCCTTCCGCCAAACCCTGAATGCTGAGTTAAAGGACTATGGAACTGGGAAAAGCATAACTCTCTGGATATTTA
TATCCAGAGTCCAGAGTCTTAGGGGTGATCCTGTCAAATAACATTTTTATGGATATATCTGCAATTATTTGAAACCTAAGAGCGAATATATATATGCAAA
AATGACGCAGAAACTAATAAACTGTTTTTTTGTATGCCCCAAAGGGTGAATGTTGACCCAGTCGGCATAGAACAACATTCACGCAACCTTGTACGAATGT
GATCCAGTCACATTCAAGCTACCTTATGGCTTCAACTTAAGAAATGAAGCCACTTGAACGACGGAGCAGTTAGTAAATACAACCAGACAAATGTCATGCG
TCCAGCTTCAGATATACATGCATCTCGATGCAGCACATGTACTCAATACGAAATTAACACTGGGATACGTTTGAAACTGATTTAGAGACGGCAAACATNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCGCTTTCACTGTTGGTCCCCTATATACATCATTATATCCTCCACACTATCCGTCTCAC
GTTACATCCGACTCCTTCCTTTCTCCATATCTCTGGCCTGCTACGCCGTGGCATTAAACTAAAACGAACCAAGATTTTCAGGGTTTTGTTATCGCCGAAA
TTTAATTTTTTCAAAGAAATGAACTTTTTCAAAGAAATGAAGATTTGGTATTTTCCATTAAAAAAACAGTTTTTGAAATGAAGACGTTTTGAAAAAAGTA
TTTTAGAATTTCAAAACGTAAAAGAAACACTTTTTTGAATGTGCATTTTAGAAAAAAAAAAAGTTTGTTTCCTTAAAAATAAATACTTTGAACGAGTTTT
ATTTTTGGTGTTGTTACGGTATATACTTCATTAGTATAATATTATAATATTAAATATTAAGTATCCAAATATCCAGAGCTTCCCGGGCGCAGCACGGCAT
TAGTGAGATATTTTTAATGTTACTATACTGAGCACAAAAGTGCAATTTACTACGTAGTTTTACGTTCCTATCAAATTATTAATCTCGCTCAAGTATCTAC
AACAAACATACTTCCAGAAAGTTTCCGTTATACCGAACTCTTGACTTGTTCTTCACCTATGCTAAGCGCTAAGCTACTATTTTTCAGTAATGACAATCAT
AATAGACCATGTATTCGATTATTGTCAACGATCTAACGTTTATTTAAAGGGCTAAATCAACCCCAATGTTGATGAAGTCAGTTTTCAAACGTTGGACACC
AGTTCTCATGTGACAAAAGTGGACACGTTTCTCCACCTCACCATGTTGACTGTGAGTCAAGACTTACCAGCTATCGCTTTATTGGCGGACATGTCGTTTA
TGAAGTTGTTTGTTTATGAAGACTGTGATTATGATGAGGTTTTTTTACCTTACGTCTTGGTAGTTTTTAATAGTTGTATTCATTCTCTAAATCAAACCAG
TGTTTATGAAGGTGGCGAATCTCCACCTGTGGAATATCTATCCAAGCCTTCAAACTAAGCAGACATGAATCACATTGCTTTTTGCACTAAAACACTCAAG
CCTTCAACTCTACTGCAATTTACGATGGTGGGAACTCGCATGGCCGCCGCAGTCGGCGCGATGACAATCGCTCACACGATGCCAGCTTCTGCCCAGAACA
TGTCGTTTAACGCCGACAACTTTTACCGCAGCAATAACGTCACCATCCAGCCCATTACGTTCCCGAACCAGTTCAAGATGAATGTCGCTGGCAATCTCTT
CACTCCCAAGAACCTCGATACGAATGGGAGCGCTCCGGCGATCATCGTCGGCCACCCCATGGGTGCTGTGAAGGAGCAGAGTGCGAACCTCTATGCCACC
AAGATGGCCGAGCAGGGCTTCGTCACCGTCTCTATCGATCTCTCCTTCTGGGGAGGTAGTGACGGAGAGCCGCGTAACGCGGTGTCGCCAGACTTGTACG
CCGAGTCTTTCAGTGCTGCGGTCGACTACCTCACTCTGCAGAGTTTCATCGATAGTGAACGCATTGGCGCCCTGGGTATTTGTGGCAGTGGATCCTTCGC
GATCAGCGCCGCCAAGATCGATTCGCGCATCAAGGCCGTTGCCACGTCTTCGATGTATGACATGGGCGCCGTAAACCGCAACGGTTTGAGGCACTCTCAG
ACTGTCGAGCAACGCAAGGAGATCATTGACCAGATGTCCCAACAGCGCTCTATCGAAACTGCCGGTGGCGAGGTGCAGTACACGAGCGGCACGGTGCACG
AACTTACTCCCGACACACCCGAAATCCAGCGTGAGTTCTACGACTTCTACCGTACGGTGCGAGGTGAGTACACGCCGCCGGGCTCTTCGACCAACGTTAC
CACCCACCCGACGCTCTCAAGCACTGCGAAGTTCTTGAACTTCTACCCGTTCAACGACATCGACACCATCTCACCGCGTCCGCTTCTGTTTGTCACCGGT
GACCAAGCACACTCTCGCGAATTCAGCGAGGATGCCTACGCCGGTGCGGCTGAGCCCAAGGAGCTATACCGGGTGGCTGGAGCTGGTCACGTTGACCTCT
ATGATCGTGTCGATCTGATTCCTTTCGACAAGTTCACCGAGTTTTTCACGACTGGATTGGCAGCGAATGCTACTCAAGGATAAATCTACCTGGGCAATCC
TCAGCGAGACAAAGCCAGAATCCCGTGACAAAACATGCAGCATCAAAGTTCGCCATCGAACTCATCACACTTCTTCTCTAAAACAATAAAAAAAGAACGT
GTTGCTGCAATTTTGATAAAGAACTGCTCCAGACTGGGCTCATAAACACCCAATTTGTGGCACGTAGCTTCCAGAAAACGTTGGGCGGGTGCATGGGTAT
GATTGAATACATTAATGAATAGGCTACCCAGTCCTATAAACCGAGCAACATTATCATAACGGAGAAGGGAGCAACGTTGTTGTGTTTTCAAGCTGGCGCT
GAGTTGGTCTATGTAGTGCTAATCCTTAGAAGGCCTTTCATAAGGACCTTTAAACCCTTACTAAGGATTTCATTTGGCTCCCAGTCTGGAGCAGCATATT
GGTTACTTGTTCAAGTTAGCCAAATGGCAAGTACTGTAACTCACTGCCTAAATTGGAGAGATCACCACAAAATGGAAATTTCCATTTCACATCAATCATT
GTATCTCGTGTTTTCAAACGTGCGCAGGTAGTCGGCAACACAGTGATCCGTAACCAATATGGACCAAACATGTGTTGATATGCTCCGCACTTACTACTAA
TAGTAGTGGCCCTTGAACCCGTCCTTTTGGTAGAATCCACAGAGAATTCCATCAGCTGTAATTCCTGCTGCCAGTCCTTCGTATGGATCGTACATCCCGC
CAAGTCTTAACTCGCTTGGTAAACCGTACAAGCCACGGCGTCGTGGAACAAAACGCACAAATTGTAGATTGGCCTTGAGGCCAGCTTTAATAGGACGGTA
AACGTCGGTACAGTGTGCCATGAAGTTCCTCTGGGGCTCCGTCAGATTATTGCAGTACTGGCAGGAAGTGCCTTCCATTCCGTTCCAGTGCTGAGCAAGG
TAATCCGGTATTGTGCGACCCCTGCCTCTTTTGTAGTCATGAAAGTAGTGCGTACCAGCCGTTTGACAAATTCCATTCATCGCTCGGGTCAAGTCCCTCT
GACTGCATGGGCACAGCTTGTTTTCTTTTGTTATTAAGGGACAAATCACAGGCACAAATCTGGCAGCTCCACGAAGAGGATATGTAGGGATTAACTTCTT
CAGTTTCAGCGCGATAACCAGAGCGTTCAGCAAAGCTTGAGCACCGCCTGGAATTCGAAGAATTGTCAAATTCATGTCCACACTGAAAGGGACGCTTTGA
ACACATGTGTCATCCGTTCGAGGAACAAAATCGAGACTTCGCATCCAGTCGCAGCCACATCCCAGCCCCAAATGAACCTTGTTCTCGGTGCAAAACTTGC
CTATGGCATTTAACGCCATGATATGAGCGAAATCGCCCGAGATCCGATATGAGCACACTTTAAGCAGGTTGGAAACACCTTCAACGCCCAAATAATTCCA
CACAATAGACGACCCAAAATCCAATACCATATAAAGTAGATTACCGGGTGCATTGGAAATCTTCTGCTTCTTGGTGTTCCCTAGATTGGCTGATGCAGCG
CGCTGCTTATCATAACGTGTCGGCACCATTATACAGTAATCCAAAGCTGAGAAGTAGAAAGAAAAAGAAAAAAAAAACGAAGGGAGGGCATTTGAAAGAA
TTTGACCAAGGTATGGGTCCCAAGAATGTGGATTGAGAGAATTGGACCACGGTGGATGGACATTATTCGTGTTGGATCCAATTGTTTTTTTTTTTTCAAA
AGTAGTTATTTCAATGTAAAATTGTTTTTTGAAATTTTAGTTGACAGCCGACCAACCGGTTTAACACATGTACTAGTACGTGGTTGTATCTGGTATGTCT
CTTCGCTGCCCTGCGCATCTGCGCTACATAATTGAACACACGTCGTATGTGCAGCATATGACGTGTGCGCTGGTATATCTTGCGATGCGAAACCCATTTT
CTCACGCTGGTCGTGTGTTCGTGTAGCGCTACTTGAGAGCTCACTTCACACGCAGTATATCATTAGGGGAAAAATAAAGGAACTGTGAATATATTGCTAA
TGAAGCCGTCATAGCAGCAGAGGCTATTGCAGCGAGGGTCTGTCGTCAATGTCCTAAATTCAATAGAAGTATATGCGGAAGCATGTCAGAATGTACTTTT
CAAGTCGTGATTACTTTGCAACATGATCCGTACGTAATGTGATAACGCTATGTACATGCGAAGTTCGTAGCCACCACGGGCTGTTTCTTCAAGAACCCGT
GGAACTATTTGTTGACGAACAAATGAAATATACGACGCGACAAGCTGAGCCAAGATCTGCTCGTTGTGCATTAGATTGGCAAGCGTGCAAGAGGTTGCTG
CCGTCAGTTCATTTTGCATTCTGCCTCACGGACAATGCACACCTTCGCTCTGCCACTCGTGACGCTTGCCGCGCTTGTATCGATTGTTGGGGCTCAAGTC
AGCACAGCGTGCAGTGGACCGTACGCACGAACTGTCCCCCCGCCGGGAGCTATCGTCGTCGATATCACGGGCGCGTACAATGACAGCTACCAGACCATGG
CAGAAGGCATGCTGTATCTACCCAACACGACCGAAGAGCACACTATCTTCATCTTCCCAGGCGTCTACCAGGAGCAAGTGGTGATTCCGCGGCTCGCTGG
TCCACTGGTGGTGCAGGGCTACACGTGTGATACTACGTCCTACACGGAGAACAAGGTAACGATTACCCACACCATGGCGCAGAAAGACCTTGCACCCGAG
ATCAAGAACAGCCGCAACGACCTCGTTAGCACCCTACGCCTCAAGTCGAGCAGTGGTGTCAAGATGTACAATGTTAACGTCGCTAACCCAACTGGTAAGA
TCGATAATCTTGGTCAGGCAGTGGCGGTGTACGTTGATGCACCCAATTACGGCTTCTACGGTTGCAACTTCACTGGTTACCAGGACACCTTGTGTGCCCA
CAAGGGTCGTGAGCTCTACGCACGGTCGTACATCAGCGGTGCTGTAGATTTCATCTTCGGCATGCGAGCGAAAGCGTGGTTCGAGTCGTGCGATTTTGAG
ACGATCGGAAAGGGGTGGATCACCGCCAACGGAAACCAAAACAGCTCCAACCTGTCCGAGTACGTCTTCAATCGTGCACGCATCTTCGGAAAAAGTGGAA
ACGGATCGACCTATCTTGGCCGCCCGTGGTATCCCTACGCTCGTGTCGTTTGGCAGAACAGTGAGCTCAGTGATGTCGTCAACCCGGCAGGTTGGGCCAC
GTGGGACAGTGTCACCAGCACGGCCAATGTTACGTTCAAAGAATTCAACAACAGCGGCCCAGGCGCTGCTACCGACAAACGTGTTTCTTTCAGCGGTCAA
CTTAATGCATCTGTGCCTATTACGGCTCTCATGGGCGAAGGCTATGAGTCTGAGTGGTGGGTGGACACGGCGTTCTTGTAGAGGATGCAGTAAATGAGCT
CCTTTGATTGTCATTTCATTGCTGCTAGCTAACCTGTCATTCAAGAAGCAAATGTTGCGTTATCTCGATTTTGACCAATGAACATTTTTTTCTAAATCTT
TAGCATACATTTAACTAAATGTTTTATAAAACTAATCCAGAATTACGCAAAAAGTATTAGTGCCCTAGCAAGTTTATGAACAGATTTTTATAACCTGACA
AGCTGACTAAAATTAATGACTTTGTTGTTGAAATGAGTGAGAGTGACTTCAAAAACAAGAAGCCTTAATTGTGATTAAAATACGATTGATCTATTAACAC
CGACTAAATGGACATCATCGCTAGTGTCACCCTGTTTAGAAACTCAAAGGTTCTAGTTGGAGCAGCGTAATGCAGCGAAGGCGCGCGAAGGCTGAGACTT
ATTTGTCGGCATCTCCTGCGCCTGCTTTTCGCTTTGCTGGCGAAGCTGCTTCACAGCATCACAACATGAAGCAAAAACGAAAAGGTTTCAGATTAATAGA
TTGATTGTCGTCGAAACATGCTTTGTGTTCTCAGCGAAATTCCCCACCGGTTCGACATTGCAAATACAAAGTCACACCGGTTCGGTCACCCACCCACCAA
ATGCAAGGTGACCGTGGGGCACTTGAAGCGGTCTGGGAAGGGAATCGGAACAAGATCCGTTGTGATGCTAACGACTTGGAACTCTTTCTGGCGAGGGTGA
ACTGCCGGCAATGGCTGAAAACGGCAGGTGTGGTGGATGTAAGGCTTGGTGACCATGGATACCCGCAAGGCTTTGCGCGAATGGAAGAAGTCACGCTGTT
TCTTAATAGCACCGACATCTTTGGAGTGAGTTTCCAAGCGAATGAGAGCGAAGTTTACGTGCTGGTGGTGGTACCTCCGGCTAGGAGTACGATCGATTTT
GATGGCACGAACTCATGGCAGACGATCTTTCATCGGGACGTAGTTGCAGCCACCTCACTACCCGCAATTGGAGTACTACGAAAATTTGTCGGACGAGCTC
TCCCTGTGAAGATTGAACTACCGAAGTTTATGATCGATGGATGGTCATTATTGCTCGGGGCAGACCTTCGCGATACGTTGTTCGACGAAAAAGACCGTTC
TCCATGCGAAAATTCATGAATCGGGTGTTCAACGATGTTTTCTTGCGCCCGCGGGTGAATACGGCCGTCAGCACAAGTGTTTACATCTAGTTTTGGGATA
CAACTATTCGCATATTGCTCGAGTTTATGTTTCCACAATCTCACGTCAATCGGAATTCGAGCTCCTCACCGGCGGAGCGAACCAACTTTTGTTTATTGTT
GATGGTGTCTGCGTCCTCCGTGGTGAGGAGACAGTAGACGGCGCTGACATCAGCTTGCTTCGTCAAAAGTTTCTGAAAAACTGGAATGGTCGTATGGTGG
AGTGCCGTATTTGTTTGGCTATGCTGCGACGGGCTTTTGGTTGGAATTAGTTGCTATCTTTCGTAGCGCTTCGGACACAGTAGAGACCCGCCCTATTGGA
ACTTTTAACTTGCAGCTGACATCGGGGTGTTTACGGCTTATGCTCGCACTCTTGAATCTGTCTGCTTTTTCCAGCCATTACTCAAAACTGTTCAAGCTCT
GGTAGGAACGAGTACTTGGACTTCACTCGCCCCGGGGGTGTCATCGTACGCTTGAGCCCGAAGTCCGTTGAAAAGATTTTTCCAACAGCAATAGAGTTTT
TGAAGACGAGAAATATCTACCATGCCTTGGAGACAGCTAAAAATTCCAATGTCGACGAACTGATTGAGGAGAATCCGGATAAAACGAGGCTGACACTTTC
GTCGCGCGATGTCCAGGTGAAGCCATCAAGCTTTTGTGAATTGTTTGTTGCGCTCCAGAATGTTCTCCAGGCCCTTGCAGTACTCATGGATGCACAGAGA
CAACCGCTGGTCTAACGTGATCAAGTGGTGTGATCGTCTTGATGGTTTTCGATGGAGGATGTAGCGAGTCAAGTCAATTCGGTTAAAACCAAATTGTATT
CGAATAGGAACCGGTTAGACCCGGTCCAAAATTATCCGAATCAAACCGGATAGAATTCAGTTCAAACCGGTAAAGAAAAGACCATTTGCCATGTTATTAG
CCTTTGATATCTAATAGAACCCTAGTAGTTGATACGGGGCATATCGATCGGGAGAGGTAAAATTCTCTAGCAAAAATACCACTACTAAACGCATCATACA
ACAATTTGTTTTGAGGTGAAACTTGTATACATTAACCGGTTTAACCGGATTTGACCCGGTCCAAATTCGGTTTAATCCGGTTGTGTGAAAAAGGCCAACC
CGAAATCCCGTTGAAACCGGTTTACATTCACTAGACTTCGTTGAAGCAGCTAAGAATGAGACGTATTTTACGTCAAGGCTCGTGCCTCGAGCGAGTTGCG
CACGAGGAGGCACGCAGCCTAAACGATGATTGGCTACAAGCACGACTCCTGAAAGGTGATTAGTGGAAGGAATACCGCTCTGTATTCTGATTGGCTAATA
AGATTTAACTTCAACTTGTAGGATTTAATTGTCTGTTGCTAGGATAACTAACCTTAGGGCCGTTCTTAACGTGGATTGCGATCCAAGAGATCGCAAGATG
AATAGGTGTCAATAATGAAGATCGCAATCCGGCCTTCTTGACGAGATTGCGATCCAGTAGCGAGGTTGTACCAAACATGTGGTACCATTGTGTGAAGTTG
CAGTTGCCGGCCAACAAGCAAAAGCAACATGGCCGCTCCCGCACCGAGCTCGAAGTGGACCGTGGCCGCACCGCTCGACTCGCGCAAACGCACCATACGT
CCACCGACCTCCGACAGCTACGAGGACTGGACTCTGGATCAACTCAAGCTTGAGTGTACGGCGCGAAAGCTTAATGTTGTGAAGAACACTCGCAAACAAG
ACCGTGTGGATCTACTAAAAGCATGGGACTCAAACAAAGAAGCCGTTCAAGCTCTGGTTGTTCGTCAACGCAAGCGATCCAAAGGGGTTAGTGAAGAAGA
GGAGAGACGCAGCGCCGGCTGCATGTTTCGGCTCATTAACGTACTCTTCTCTGATCGGTTTTTCGACTCGTTCCTAACGTCCGGAAATTTGCTCCCGCGT
GACGTCCTCGATGATGGAGGCTCCACCTTTTGGTTTGATGTGGCACATGCATTTGCCTCAGATACCACTGAGTACGACACATTGATCTCGGGCGACGCTG
TCTTTGAAGACATCGACACCTCCTCGCACATGGCACATTCGGCAGCCAAGTTGAAGAGGATGTGGAAGGAGGTTAGCAGCCACTTTGCGAGAGCTGAAGC
TGGTTCAAAGGTGTCAGGACAAGGCAGCGCTGACTTTTGGGACTTTTGCGATGGTCGAGCCGACGTGTACTATTTGGACAAGTGGTGTGAGCACCGTCAA
GCCGGACGTGAGTTCTGCTCTGCCAACTTGTATCCCGAAGACGAGGACGACTCCACCCAAGAAGGTACCAAAAGACAACCAACGTCCCATAATCGCAAGC
GTCAAAAGCGGGACCAGACGGCTGTTTTCAACGCTCTACTCGACAAAATTGACACATTAGTTGGTTCGGACGTTGACAAAGCTCAAGAAGACACTTGGCG
AGAGCAAAAGTTATTTATCCAAGAACAACGGACCGCCCAAAAGCTTTCTACGCTGTCTGCAATGCTGGCACGTAACGCGTCCATGGCGCAAGAACTGCTG
GAACAAAGGCGACTGTACGTTGAGCAAGGCCTTGATGCAGCAGAAGTTGGCCACGCACTTGCTGAATGCTTGGAAAAGAAGAAGATGCTGGAATCAAACA
TCAACGAGCTGGAGTCCGACATCATCAACGGGTTACGCTAGCTGTGCCGACGTTTGGGCCGCTGGAGCCCACAACACTGAATATGATCGACAACCACTTC
ACGAAGAATGGGCCCCTGAGCGTCATTACGTAAGCCAACAGTAGATTCAGAATTGTCTGTCGGCTGATACTCGCTCTCGGGCAAGTTGTGGTACTCCATC
GACACAACTTGAAGTCTCTTTGCGCTCTCTTCATTTTTAATTCTCTCGTCAATGCAAAAGTTATGCAGCTTCATGCACGTCTTGATCACCTTATTCACGT
TCACAAAATCCACAACCAAAGCGCGCTTGAAGATACCCCACTTGTTGACCAACAGACCGAAAGCCATTTCAATGCGAATGCGCAATTGGCTCAGATAGAA
ATTGAAGTCGGAGTGCTTTCGGCTTTTGAGCTCCAACTTGTTGAATGGTACGAGCAGCGAGTCGGACAACGGGTACGCGTTGTCGCCAACTAAATAAAAC
CCAACTGGAAGCTGCATGATCTCCTTGCTGAGCGGCCACTTCTTGTACGCAATTGAATCACCGACCTTCCCCGGGGAATTCATGCAATAGCCTGTGAAGC
GGGAGAACGCGTCACAAATGGCTTGAACATTGACTCCGAACTTCTGATAATGGCCCGAGAAGAATGCAGCTACATCTGGAACCTCGTTGGGGCTTGGGGC
GCGAATATGACACAGCCACCCGTCAATGCACCCGACACAACCCGTCAAAACGCCATCTTTGCTGATGTTTGTAAAGCTCTCGGCAAGGTCGTGGATGCGT
TCTTGTGACTCCGTTGGAGAATGAATGCGCAGCTCAGGACAGTGGCATATGGCGTCCATAACAGCATGCATACATCCATAGATTCCAGAGGGAGACATGC
CAGCCAAACCACGAATAGTCATGTAGTTGCCTCCGGCTAGCCAAGAAAGTGTCATTTGTAGCATGTTCTCAGGCTCTATTGGGTCGGCTCCTGTTTGATT
CGTCGACTTGATCTCGTCACGGGCTAGTGTGGGCCTAATCAACGATAGCAACAGCTCAAAAGACGAAGCTTCCATGCGGTAGCATCTTTTGAATTGGCCT
TCCAGCAACAGTGTCTGCTTGTGAACGTTCCTGTCCAAACGACGACGGAAAACGCACGCTTCTCGCTGCTGTGGTGCTTCGACAATAGCCGCCCCAACCA
GGGCGACAAAGAGAAGCCGGCGGTGGCCCTGAGTGGCTTGCAAATTTACCATCCAGCCTGGACCTACCATTGTTTTATTCTCCAGTGGCTTTGCGATCTC
GCGATCCCTCGCAGCGCGCGATCTCTACCTCGGATTTTCGCGATTGTGTAATCTTCAAAATAACCCTTTTCCGCATGAATTTTTGTCCAATCAAAGCACA
CTTTTTGGGATCGCAATCCCGTTAAAAACGGCCCTTAATACACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGACTCCGTTGGAGAATGAATGCGCAGCTCAGGACAGTGGCATATGGCGTCCATAA
CAGCATGCATACATCCATAGATTCCAGAGGGAGACATGCCAGCCAAACCACGAATAGTCATGTAGTTGCCTCCGGCTAGCCAAGAAAGTGTCATTTGTAG
CATGTTCTCAGGCTCTATTGGGTCGGCTCCTGTTTGATTCGTCGACTTGATCTCGTCACGGGCTAGTGTGGGCCTAATCAACGATAGCAACAGCTCAAAA
GACGAAGCTTCCATGCGGTAGCATCTTTTGAATTGGCCTTCCAGCAACAGTGTCTGCTTGTGAACGTTCCTGTCCAAACGACGACGGAAAACGCACGCTT
CTCGCTGCTGTGGTGCTTCGACAATAGCCGCCCCAACCAGGGCGACAAAGAGAAGCCGGCGGTGGCCCTGAGTGGCTTGCAAATTTACCATCCAGCCTGG
ACCTACCATTGTTTTATTCTCCAGTGGCTTTGCGATCTCGCGATCCCTCGCAGCGCGCGATCTCTACCTCGGATTTTCGCGATTGTGTAATCTTCAAAAT
AACCCTTTTCCGCATGAATTTTTGTCCAATCAAAGCACACTTTTTGGGATCGCAATCCCGTTAAAAACGGCCCTTAATACACTTTCCTATTTTACCTTCG
GGTTGCTACGTCTCCTCTGCCTATTACATCGACCACACCGATAACAGCTGTTACCGTTCGTTGTCTGGCCGCCACCATTCGAACTTCCTAGGTATGCAGC
ACGCTGTTCCGCCACCGGTACCCTGCTAACACCCGGCTTCTCTTCCATGGGCGCCTGGCGCACCGCCATCTTCAACTTTCTCGGTTTCGGCTTGCCCGCT
GCCCCGTCATCACTCGAATCGTCTCTCTCTCGCTGCCGTTTCGTTTGAGCGGCTGTTGCCTTGCCTTTCTGACTACCGTGATGCGTGGAAGCGCCTGACA
TCCGCTGCTTCTCCTTCTTCTTCGGTTCGTCCCAGTATTTGCCATTCCAGATGTGGCCTGGTGGCGGATCCCAGGTCCCCGATATGCGTTGTAAACGCCC
TGCGGATTGGTGAATAGAGCCACCGCCTGTATGCTTCTATTCGCCGCCGAACCATCCTCACTAGCCGCCATTAGTGTCGCCAATCCAGTGCCACTGATAC
CGGGTATCACGCTTGTCTGACCTGTGGTTCCGTCCATGGGTATGACGTATCGACAGGGCGCGGTTGCCCACGACTGCCCGATGTTGACCATCCCCTGGGC
CACGTTGTCCATGGGGTCGTCAATTTCCGTGGCCTTGTCAACGGCCTCCTCAAGAGTTCCGGGCTTTGGGTCCTACTTGACGAGCTTCTTCGTTGTTTTG
TCGAGGCACCGATAAAATTGAGCTAACAGAACCCTTTCACTCACTTTGTTTCGACCGACCACGTCGCGAAGTCCGCCTGCGAAGCCGGCATGTGTTTCGC
CTGGCATCATCCTCCGCATGCTCACACGCCACTCTGCCGCCGACTTATCCAGCTTTTCTCCATATCGTCTCAACAGGGCCTTCTTCAGGTAAGTCCACGT
CCTGCGTTTCTCAATCAGACGCCGATCCATGTCTACCCACCACTTTGAAGCATTCTCCATCAATTTGTTCCCGAGAATAAAGTAAAGAGCCTTGTCTGAC
CACTTGCCTCTCCCACTTTCTTCTGTCCCTTTCAATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTCCA
CGAGGTCGATCCACGTGCTCACGCTCACTTTTGGTGACGGCGTGAAGGTAGAAAGTTCCAGGTCCTTCACGTTCTTACTGTGTGGTCGCCTCTCTCACCG
ACGTTCTCGTTGCTCATCGTGTCCTTGCCGCCCGCGTTGGTCATCTCGCCTTCGGCGTCCGTGTCCACGACTCCACCCGTTGAAATCACCGTCCGAACTA
TCCGACTCACTGCTGGCCCCGTCACTACTGCCCGCGTCGAAATGGCCGCCAGCTCTACCGCGTTCATCACCGCTGGAAGAGTCGCTTGAACTGTTTCCCC
CGATGACGGCGAACTCGCCTGCCTCACACTCCGCTGCGTTGACCGACGTTCACCATCTCGTTGTCCACGCTGGTCGTCTCGCTGATCACCACGCCGTCCA
CCATGACGACTCCGGCTACTTCGATGATGCCCCTCACGTCGAACCTCTCCACCTCGCGATGCTGTGCTGTGAGCGCTGCCTGGCCGTGCCCATTGTCGGC
CAGTGTTCACACGCCCCCGCCTCTCTTCACGTCCTGGTTCATCGTTGACCGGCTGGAGCGTCTCTACCAACTGCCCCAATCGCTGCAAACTCGCCCGCGT
TCCTGCCAGCTCGTCTCTCTTCTCGCGCTCTCTGTCACCCCCTCTGCTGCTTGACGCCGTCAGGTCTGCGACCGCCGAGACGAGCTGCTTCAGTGTCTTC
GCCACCGAGGCCACACTCGCCACAGATCGCGACTCCCCTTCGTCGTCTGCGTCCACCTCGTACGTCTTGCGCACGGCCGCACTGCCACGCTGGAGGCCAC
TAACCACGGTAGTCAACTGCTGAAGAGCACTGGCAATGGCTGCCACGCTCATCACGTCGTCACCACCCTTCGCCTCCTCGTCGCTTGGCGAATCCCTTGT
CACCTTCACGGCCCTAAGCGTCTCCGTCTCTATACTACTCGATGTCGATCGTAAACGATCACTCCGCTGGCTCACTGCTGCGAGAGCGTGGTCGCCGAGC
TCTGTAGCTTCCTTGGACTCTTCCAGTTCGTCGGCGTTCCTCCTGACAGCCGATTCGCTGGACTTTCTTGCCCCGCATCTCTTTGGTCCATGCTCCACTA
TGGCATTCGTCTTCTTGGCTGCAGACAGCCTCGTAGTAACCATGGTCGCGTCTTTCTCTTTCCTCGATTCTCCTATTGCTGGTGACCTTGAGTGCGACCG
CAAACTTGCACGTCTCGACTCGTTCGACTCTTGGACCGATTGAGGCCCCTGTATGACCACCATGTGACAAGTCTACGTAACGCCTGCTTGCCGGCGGGTC
GTAAGCCACAATACCCGCTGCGTTGTCTTGCCCCAGTTCGCTCTTGTCGTCCGTCAAACTAACACAATCGCAGGCCACCGCAAAGCAGCCGGACTTTCGT
CCTATTTTATTAATACTCAATAAAGCACTAACTTAGCGCCTTTTGACTCGTTCCCACTCGTCTTGTATGCTCCGTTCTTCCTTTCCGGAGACTTCCCGTC
AACGACCACTACTGTCCTTCTGATTCGCACTACGAACCGCCCCTAAGATCCCACGCACGAGGCCTTCTCTCAGCAATGACCTGAGATTCTCCTTCCAGAG
TCACTACCGCCAGACACCGCACGCCGCCTTAAAGCCCAGTCCACCGTACTACTCGTCCGATCAACTGTAGTCCTTCGGTAGTGCGTCCACCACCGACTCG
CTCACCACGCGCTCGTCTCAGGGCTTGTGCTCACCGATACACAGCACCACGCCTTGCCCTTCCACGAACTCGTCACCACGCTCGCAGTCAGCTCCACACG
CACGAGCCGACTCCGTAATACTCTCACGCTCTGGCCTGTTCGCCAGCCCGCTGATTTCAAAGTGAGCGATCAGCAGCTCGCCCCCCGACGGCTACCGCCA
CTGACCTCCACTCCAGAACCTACAACTAGTTCCTGGCACCTGCCGTGCCGATCCCTCCAAGCCCTGTCCGGGCCGATCGTCCCACTCACTAACGAACTTC
GAACCTCTGGGCAATGTCGTACCCGCCCTCGGCTGCACGTCATTACTCCGCATCCTTCGGCCCTCTGCCGATCTTCAACCACGACCGCTGGTGGCGGTCT
TTGGAACTTCGCCGCTTATGCCGTCAACTTTTGACACCGCCACCGTCACTCCGTTACATTTAGTTTATTCAAGTGAATGTTTTGGTTCCATCACCTTCTG
TTAGAAATACGGTATCGGATAAATTTACCATACTGAATCCAAGTCAGACATTCAATTTATCAGACCTTTTCCTATTTTTCCCGGCTGTTACAGAACCCCG
GCAGAGCTCGCCTGGTCACAACCAGATTTGCCTCGTGGGGAGCAAAGGTCGCTTCCTTCCTGTGGTGCTCTGCATTAAAGCGCGTTTAAGGCGATGCCCC
CTCACTTCGGGTACGCTTTAGCTCTCACTCCCGCCACGGACGGTGGTTTCCCCGACGTTTTACGCTCTCTGGAAGAGGAATTACGACGATAAAACGGATT
AAAGCTGACATTTTTTCGTGTTGATTGAATACGTGAACTCTTAGACAGGAAGCGACCCCGGTGGTGATGAAGCGAACAGAGGAGACTACGGAGCAGCCTG
AAGACGCAGCGGAGGAAATGCTGCTAGGCGTGACGGCCAAGGACGTCCCTGTACTTGACACGCCGGAACGCATCGTCGTGGATCACCCGGACAAGCTCGT
AGCTGCGTCCCCCGTGCGCCGCCGCAAACGCGATGTACTGCGCCAAGTGTCCATGCGTCTTTATCTCAAGGGCAAACACGTGGCTGATGACGTGCTGCGC
AACGTGGCACCTTCCCGACTGGCCGACGCCGAGGAAGTTTGCAGCGACGCGCAGTCGAGTCTGGATCACGAAATCCGAAACTCCAGGAAGACGAGGAAGC
ATCTTTGGCTGCCAAAGACGCAGGACGACTCGGTACTACTGGACTCGTCCAGTTCTCATAAGGATCACTCTGCTGTACAAGAGTTCTTTGTATCTCGCGT
GACCGACCCGACGTCATACTTCTACCGCTTCCACTACGACGACTACCATCACTTGGCTCCTCAGAAGGCAGAGGTACAACTCGTGGATGTCAAGTGGCTG
AAGCCTCACGAACAGATCGTGAGCTGGGAACGAGTCAATGGTCTCAGGAAGGCAACACTATCGTGGGACGCATACACGGAACCTTTGCTGGTCGATATCA
AGACCGGTGCGATCTTAGATGGCCACCATCGCTACAATGTGGCTCTACAGTTGCGTCTCAAACAGGTTCCAGCGGTGCTGGTGGACTACTTGGGGGACAA
AACGATCCACGTGGACGTCTGGCCAGGTTGTGGACGATCGCATTTAACCAAGGAAGAGGTTATTGCGATGTCTCTATCGCCGGATGTGTTCCCTCCCAAG
ACAAGTCGCCACAGATTAACTGAGAGCTTGCCGCCCATTTCCATTCCGTTGTCAGTCCTGCGTCAACCGCCTCTTCCTATTGAGGAAATAACGAAGCAGA
CAACAGTATCGAGCGAGGAGATGCAGACGGAAACGTTACGCTCTCTGGAACGCAAACCCAGTCTACAGCAAGTGTCTATTTTCTTGATCTGTGGTGCTCA
GAACTTGGCTGCATCAGTGACTAAAAGCCTGTTCCGGGGCCGTCTGCGCTCCGTTGATCGTATTCGCGAGTCAACACGGATGGATCTCATCAGACGACCA
TCCTACGACCCGAAAGATTTCTTTAACGCTATCCGAGAGAATGACCCGACGTCGAGTTTCTGTCGACAGAAGGCTGCGACGCTGGAAGACCTGCTGTCCG
ATGATAAGGAACGTCGTCAGAAGTTCTTCTTGACGCGTATTGCAGACCCGACGTCGTACTTCTACAAGTATCACTTTGATGCTCGTCCTCAGCGACAACC
GAAGAAATTGGGGGTGCATTTGGCAATGCTGAGCTGGCTGAAGGCACACGAGCACGTTGTGAGCTGGGATCGCGTTGATGGTCTCCGCCGCGCTACTGTG
CGCTGGAATGCGTATCTGGAGCCGCTACTTGTGGACAGAGCCACAGGAGCTATCCTAGACGGCCACCACCGCTATAATGTGGGACTTCAGCTCGAGTTAC
AGTGCGTGCCAGTAGTGCTGGTGGACTATTTGGAGGACGACACAATTACGGTCGATGTCTGGCCAAAGTGCGGTCGTGACTCACTTACGAAGCAGGAGGT
GATCGATATGTCGCTTTCGGACGATCTGTTCCCACCTAAGACGAGTCGTCACTCGTTTTCGGACGATTTACCGCCCATTTCAGTCCCACTGGAGCGTCTT
CGGCAGCCACTGGATACCAACTTTGTTCCGCTGTAATTTTGGTTGATAGTGAGTACGAAATTGCAGACACAAAGAGAGGAGATATGAGTGGTGCCATTCA
GTACACGTACATTTACTTAATCCAATGAGCCTCAGATTCAGCAGAGCTGTGGCACCGTATCGGTAGTTCATTCACTTCCAGATACAATCGTGACTTGGAT
GGAAGTCTGAGCATCTTGATTTCGGTTTCTGACGCGTTGACGCGCACGGTCTGCGAGCATTTTGAGCTTCTTAGTGATGAAGGTCTTAGAAGCCACGGCT
TGCAGACGTGATTGCTGCGACTTTGTATTCCAGACGTCGACGATATCATGCACGTACTTGTCGCTCTCGTCCTCGATTTCTTCCTGGATGAGCTCTTCGA
TCACATCTTCAATAGTCACGATACCCTCGAACGCAACGTGAGGTGGAATAGGCATGTTGTTCCTCCAACAAGTTGCCACAAGCTCTGTTTCCTTGGTGAC
CAGAGCAATATGCGAGCGGCCTTTTTGGAACTCATTCAGCATCGAGTAACATGATCCACTAGGTGGCACAAGAATGGGCTTTCGGAGCACGAGATCTCGA
ATCAGACGGGCATCATCGGGGTCCAGCACGATGAGCTTCTTGACGAAAAGTAAGCCGACAATATTCGATCTACGGGTTTCGTACACTGGGATACGACTGT
GGCCTGAAGCCAGGATATCCGCCATGGTATTGTGATTCAGCTTGGTATCAATCTCCAGCATGAATATCTCGCTCATAGGAATCATAACTTCCGTCACTGT
TTTACAGGAGAGATCCAGTGCGCCGTGGATAATGGTGACTTCATCGACGTTAAGTCGCGTGCCACTTGCCAAAGCTTGCTGACGCCGGCGCTTACGTTGA
TTCGGAGACTCAATTTCCAACTCCACTTCGACTTCCAGTTCCGGTTCTGGCTTGAGTAGCGGTTGCTTTCGCAATGTATTGGGAGACATCAGGACGCTGT
TACTAGTACTGCTAATATGTGAGCTCAATTGAGACTCCAAGAAACTCTGTCGCACAGCTTCGCTATCACGCTGAAGTGTCACGAGAGCTTTTAGCTCGTT
ACGTTTGTATTGAGCTGCGTCGTGATCGGCTCCAATCCACCAGTCTAGTAATTTGCTGATGGGGTAGGCAATCGGGAACACGACGGCCATAAGTACCTTG
ACACCGGGGGTCAAGGCAGCGGCGATACGGAGCTGGTTGGGGCCTGTGAAGATGGCAGATGGGATGATCTCGCCAAACATGAGCACGCATGTGACAGAAA
GAATAATGGACACACCCTCGGGCACCAGTTTGTCCAAGAAAATGGGGAGTGCTTCGTTGGCACTGGCGTTCACGATAAGTAACGTGACTAGCAGCAAGTG
ATGGCGCTCCAGCACGGGGCGCACATTGCGAGCGTATTGTTTCTCAACTTCAGTGCCCTCCATCTCGAGGATACGAACGTTGAGCATGTCTAGCGATACG
AGGCCCATGGTGAGACCAGCCATCAAGCCTGCTGCACATACAAGCAGCACGCACACGCACAGGTAGGTCCAGAACGAGGTGGAGTCACATGATGGCGAAA
AATACTCGCATTCTTCGGATGCCATAAGCGGGGGAGCAGGTGGTGGCTGTTAAGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNN