Description :
From Genome Similarity Track
Location :
Scaffold_1:120139- 121497
Transcript NameFunction/comments
Phypl_g41hypothetical protein

Sequence
1358 bases(100 bases per row)
TCGAAGCTCTTCCTCTTTTGCTTTTGTGCGGGCTCGTCCGGTTTGTCAGCAGGAGATACACCGATGGTGGGTTTACCTGTGATCCTGCTGAAGTCTAGTG
GCGGGACTGCCAGCTTCTGTGTCGGTGGTGGAAATGCATCAGATTCGTCATCCTGGACTTCAAACTGggcaggaacagcagctgAAAGCCGTGATCCTGC
CTTGGCGCGAGTGGATTGCCACTGAGGTGGTATGAACTTTGGTTCATTGGGTTTCACCGTTGTACGCGAAGCACTTGGAAGCGGGGCTACTGGTTGCAGC
TTTAACAGAGGGAGGTTAAACTTTGACGGACGTCGTACAGCTTTCCGCTCCAGGGACGTTGGCGGCCGGCGACTCGATTCTGGTCGGCTTTTAAGCGAGC
GCTTGTACTCGAGTAGCTCCTCCTTGTGAAGCTCCATTAGCTCCCTAGACATGAGCGTGATTAATCAGTGAGTGAGCCCTTTTACTAGCATAAGTGAAAA
CTTAAGTTGGGACGATTCGTGTTGTTACCTGAGTGAAGGCTCGTCCTCGGTGGAGGTATTCCAGTTGTCACCGTGGATCTTCTTGCCTGCTTTCATAAGT
CTTGTCCAGTCCTACGAGGCACCTTAAAAGTTAGTATGCATGTTCGCTCCGAGGCAAATGGATCAAAAGGAGCAATACCTCCTCGTCGCGTCGACTGGTT
TCCACGCGAGAAGTCACGAtttcctcgagctcgtcgtggtACCGTAGCTGATCCTCTCGAGCGGCGAGTTGCTCTCTGAGCTTGCCAATATAGCGTTGGA
GGTCTTCTTTGCGCTTCCCAATCTGTTCCAACACACCTCTGCTGGACTGTTGAAGTTGCAAGGGAGGGTGATATTCTACAGCGCAGCACAGAAGTCAGGA
ATCGTGGTATCCTGTCTGGCATACGAGGAGCAATGTTTACTATGCGTACGAGTTCGTCGTTTGCGCTTgagcatctgctgctggaggaagccCAGGACGA
CTAACGCCACTAGCACGCAGCCAATGATCAAACCTGGCATGCTCATCGTCGAGCCCGCTGCCCCTCGAATATTCGGCATGTTGATTATTCAGTGGCCTTG
CAGTGCAAGTCGTGTTAGACATCAAAGACCCTGCCAGGTTGAAGCCGTATTTTTAGGCAAACGTTCTTATGATGCGAacggaagctgcagcgagggCAAA
ATAGGTTCTACGTCTTGGAGCTGCCCTGGCAGGGTGTCCATCGTCGGCGACATTTGCCGCTGTGTACTCCCGCGCCACGCATCCAAGCTCAGGGGGGTTC
GCTGGCTGCAACGTCACTTAAGATGGCAAAGACTGCGGTGGAAGGGGCCTCCGGAAGG