Description :
From Genome Similarity Track
Location :
contig_44:120133- 121508
Transcript NameFunction/comments
g9776.t1hypothetical protein

Sequence
1375 bases(100 bases per row)
ACGTAGCGGGGAGAGGGGCGAGGACAGCTAGAATGTAGCGTCTTGTGCGTGTTTGGTGTGCTTGTGTGCGTGAGTGAGAGTGGTGCGCTTTTGACGTGAG
GTCGGTGACTACCATACGAACAGCAAACGAGAATATTGCTGGCAGAGCGGGGTCTTACCAGAGCCAGATAACCTTCCGTCCAACCGACCGGCTTTTGAAT
GACAACGACAGCGGCCTGCAAACAACTTCTCAAATCAGCGAAAGCAAAAACATTGTGTAGCACCCGACGACAGGGTTTGCTTCAGTTGGCCCCCCATTCG
GGCTTGCTCACATTGGCGGCGTGAAAGCTTACTATTGTAGTGTATCAAAAGTCTTGCAGCAAGACTCTTGCTACATGCGGATATCGGCCAGGCGGCAGAT
CTGCCAGAAAAGGAAACTCCACACGTCAACTGTCGTTAATAACGACTCGTTACATGTCAAGGCGACAACTTGCGCAGCTTAAACATACTCGCACCAAATC
TCAGGCCCATCTCGGGTCCTGAGGGGATCGTTGCTGTTGCCACCACTACTTTTCGCATCACGATGCACATGCAAGCGTGAGCACTTCACCGCAGGCAACC
TGCACGTCACTCTTTCGAGAATAGTAACTATTGAAGTAAACCTCGACATACAAAAACCAAGCCCGCTTATTTATAGCTCGAGGGGGTTTGTTCAGTATCT
TAGCACCCGCTCAAGAAGCAAGCAGCAGCAAGCCTTTAGGAAGGACAGCAGAGCAGTCCGACGCCAGCTAACTCCCTGTCGTCGCCTCCTCTCCCTCGCC
CTCCCCCGTCCCCGCAGTTCTCCACCATGTCCGCCGCTCCCGAAGGTAGACACCGTCATCCCTAATTTACCGCGCAACGTTTTATCTAACCGTCATAAAC
TATTGTCACGCACCCAGAGCCCGTGACCACCATGGAGGAAGCTATGGAGCAGGCAACCTCGACCGCGACCCCCGCGGCCTCGACCGGCGGCTCCGGCGGT
GGCGACAAGCCACTGGCGCCCCGCAAGGAGCGCAGCAAGTCGCGCGACGCCGGCAAGCGCATGGGCGGCGGCCAGAAGGTCCTGGCAGGTGACGGAGATC
CCGAGCGCTGTGCCATCCGACGAGCACGACCCGAACTACGACAGCGAAGCGGATGAGGATGTGGTGCTCGTGTCCACCGTTGCCGGGTCCCCCAAGAAGA
CGACGACGACGCTCGAGCCGGACGAGCTGGCGGCCAAGGAGCTGGCGCTCAACCCGCCGCCCGAGACGAAGAAGCGCATCATCGAGATCCTGGACGAGTA
TTTCACGAGCGGAGACGCCGACGAGGTGCTGAGCTCGCTCAACGACCTGGACGAGCCCGAGTTCCACTACGAAGT