Description :
From Genome Similarity Track
Location :
contig_44:120117- 121492
Transcript NameFunction/comments
g9324.t1OWZ18179.1 Programmed cell death protein [Phytophthora megakarya

Sequence
1375 bases(100 bases per row)
AACAAACGAGTCAACGTAGCGGGGAGAGGGGCGAGGACAGCTAGAATGTAGCGTCTCGTGCGTGTTTGGTGTGCTTGTGTGCGTGAGTGAGAGTGGTGCG
CTTTTGACGTGAGGTCGGTGACTACCATACGAACAGCAAACGAGAATATTGCTGGCAGAGCGGGGTCTTACCAGAGCCAGATAACCTTCCGTCCAACCGA
CCGGCTTTTGAATGACAACGACAGCGGCCTGCAAACAACTTCTCAAATCAGCGAAAGCAAAAACATTGTGTAGCACCCGACGACAGGGATTGCTTCAGTT
GGCCCCCCATTCGGGCTTGCTCACATTGGCGGCGTGAAAGCTTACTATTGTAGTGTATCAAAAGTCTTGCAGCAAGACTCTTGCTACATGCGGATATCGG
CCAGGCGGCAGATCTGCCAGAAAAGGAAACTCCACACGTCAACTGTCGTTAATAACGACTCGTTACATGTCAAGGCGACAACTTGCGCAGCTTAAACATA
CTCGCACCAAATCTCAGGCCCATCTCGGGTCCTGAGGGGATCGTTGCTGTTGCCACCACTACTTTTCGCATCACAATGCACATGTAAGCGTGAGCACTTC
ACCGCAGGCAATCTGCACGTCACTCTTTCGAGAATAGTAACTATTGAAGTAAACCTCGACATACAAAAACCAAGTCCGCTTATTTATAGCTCGAGGGGGT
TTGTTCAGTATCTTAGCACCCGCTCAAGAAGCAAGCAGCAGCAAGCCTTTAGGAAGGACAGCAGAGCAGTCCGACGCCAGCTAACTCCCTGTCGTCGCCT
CCTCTCCCTCGCCCTCCCCCGTCCCCGCAGTTCTCCACCATGTCCGCCGCTCCCGAAGGTAGACACCGTCATCCCTAATTTACCGCGCAACGTTTTATCT
AACCGTCATAAACTATTGTCACGCACCCAGAGCCCGTGACCACCATGGAGGAAGCTATGGAGCAGGCAACCTCGACCGCGACCCCCGCGGCCTCGACCGG
CGGCTCCGGCGGTGGCGACAAGCCACTGGCGCCCCGCAAGGAGCGCAGCAAGTCGCGCGACGCCGGCAAGCGCATGGGCGGCGGCCAGAAGGTCCTGGCA
GGTGACGGAGATCCCGAGCGCTGTGCCATCCGACGAGCACGACCCGAACTACGACAGCGAAGCGGATGAGGATGTGGTGCTCGTGTCCACCGTTGCCGGG
TCCCCCAAGAAGACGACGACGACGCTCGAGCCGGACGAGCTGGCGGCCAAGGAGCTGGCGCTCAACCCGCCGCCCGAGACGAAGAAGCGCATCATCGAGA
TCCTGGACGAGTATTTCACGAGCGGAGACGCCGACGAGGTGCTGAGCTCGCTCAACGACCTGGACGAGCCCGAGT