Description :
From Genome Similarity Track
Location :
Scaffold_143:120116- 122877
Sequence
2761 bases(100 bases per row)
TCGATGGAGTGACTGGTCACGTTTATGGTGAAGTCGACCTTGCCCCCCCCCCTGTATCGTTAAATGCTCTGTTAGAGCTAGACGAAATGTCTGTGGATAA
GTTCATTCAGGCCTTGAAGGCAGGAGACTTATCCAATACGGTGATCCTTAGACCCGATAACGAGTTGAACTCATCGTCCCTCTTGGATGATACGGTCCCT
AAAAGTACAAAGGTGGCACCTAGTGCACGTATTGGGTCATAGACTTTAAAGATTCCTTCAGATCCCTACTACCCTTTAATTAGGGAATTTCAAGACATGA
TATGTCGTATCCACTGTCTGTTTTACCGCTATATAGAGGTGTCCGTCCTGAAAGTGACCTGGTCCCGGGGGCCAAATATTGTGTCACATGATAGTGTCCC
TTGCCAAAGGAACAGTGTGATGTCATTAATGACTTCTTCTGTGCCAAGCATGAGGCAGAAATCGTACGTGAGAGTAAATCTCCTCATTCCACTCCGAAAG
TTTGCGTCAAAAAGCCTAATAGTAAGTGGCGTATTATACACGCTTATAATAATCTTAATGCGGCCACTATACCGGCACAAACACCCATTTCTAGAACAGA
TGTTCTCTAAAAACAACATGATAGGATGTACAATGTACAGTGCACTCGACCTGGTCGATGGGTATTATCAACTGCTTATGCGAGCAAGTGATATCCCAAT
CACAGAGGTTAGTACTCCAATTAATATGCTTTGGGAATGGCTGGTACTGCCCCAGGGAATTTCCAATTCCCCGGCTACATTCATCGTTTGGTGACGCAAC
GGTTCCGTCCTCACTGTGCAAATGCACAATCGTACTTTGATGACACATTTGTTTAGAGCCGTGTAGAACAGATTTGGTCAGACGTGGAAAACCACATCTA
CCACTTACGTACTTTGCTTAAGTGCATGCGCACACATAAGCTGTACGCTATTGCGTCAAAATGAATCTTCGGTGCGGACGAGATTCCGTTTTTGGGGTGC
TTCATTGGAAAGCGAGTCCTGAAAGCGGATCCCGCAGAGGTGAAAGCCGTAGAGGATTGGCCAGTTCCTCAGATCTAAAAGGTTCTGTGCAAGTGGCTTG
ACCTTGCCAATTACTCAAACAAGTATAGCAAAAATTACGTTGATATGGTTCTACCATTGTCCAATCCATTTAAAAGGATGTGGAGTGGTGATGGACTAGC
ACCGAAAGTGAGGCTTATAAAGCTAAAAAGATGAGTATCCTTCATGCCTCAATTTTGTCTTTGCCTGACCCTGATCGACCTTTTAGTGTCGTCTGTGACG
CTTCTGATTTTTTCATTGGCTGTGCTCTGTTACAAACATGTGTTGATAGACGCGAGCGTGTCATCGCTTACGAATATCACCAGCTTAAAGCTGATGAAAA
AAACTATCCAGTTCATGATAAGGAGCTACTTGCTATGAAGTATGCTCTAGTCGTATTCAGAGTATATCTACTTGGATCTAAGCCTTTCGTGGCCTAAACC
GAACATGCGTCTTCAAGCACTGCGACCCAATCGCCTCACCCCCCGCAGATGATGAACCGTTTTTTTAGTCTTTGCAGCATACAACTTCGAGGTGAAGTAT
AAGCTGGTGAGGCACAACACTTTGGCTGATGCGATGTCACGCCGGCCTGTTTAGAGCTTGCTCATGTTACTATTCCGTCGTCGTCAGTTATTGACTTAAT
CCCGTGAGTCCTATGCCAAGGATGAAAGATTTGTAGGCGTACTACGAGCTCTTAGAAGCGATGAGTTTAAGGATCGGACATTAACTTGTCGGCACGATCG
CGTGCGGGGATATTCTGATACTCTATCGAAAATGACCTGATGTGCTATCGCATAGATACTGCGGATGCCCCGCACATCATTGTTCCTCATGATGAAGGAC
TGAAGTACCGAATCCTCTATAATGTCCACAGCACAGCGATAAGCGGTAATCCCGGTCTTAAGAAGATCTGTGGCTTAGCCAGCCAGAGTTATTGGTGGCT
TAAACTATATAAATAAGTAAGAAATTATGTGCGCACATGTGAGACGTGCCAACGGGTAAAGCCTTCGCACATGCGGCTGCGCCGCTGGGTAGTTTTCGTG
TACCATCTTGGCGTTGAGAGTCCATCATCATGGGCTGTATATTGCCTACCGAAGGATTCGGCCGGCAGCACAGGTATTATGGTCTTTGTCAACCGTTCGA
GTAAGACGTATCACTTAGCATCTGTGCCAGACTCCATTTATGGTGAAGGTACAGCTTTGCTGTTCATTGATCGTGTGTTTCGACAACACGGTCTGTCACT
GGCAATTGTCTTGGACAGAGATCCTCTTTTCACGGGAAAATTTAAAATGTCATCTTCAAGTTGCTAGGAACCCGATTAGACATGTATATAGAAGATCATC
AGAAGAAATGGTTAGACTGAACGCGTTAGTCGCGTCCTCGAAGATGTTCTACGCAGCGTGTGCGCTGGTACGTCTCGGCGCTAGAGCTCAATGCTCCTCA
TTGTTTAGTTTGCCATGAACAATGCCGTTCATGCCTTTACAGGATTAACTTCGTTCTACGTGAGCGGCCTCACCCCCCCCCCGTTTCATTAAAGCTACCA
CTACGTGGCTCAGAGCTTGGTGGGTGAGAGGTGGCTGATTGGCTTGCTGGTGTCAGCCCTGCTACTATTCAAAAACAAGTTCCCGCGATCCTCACAACGC
GATTTAATGTTTTAATACATGTGCGTGATGCAATGGCTGATAGCCAAGACGAACAGAAGGA