Description :
From Genome Similarity Track
Location :
Scaffold_150:12011- 17716
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_150-fgenesh-gene-0.2Flagellar protein

Sequence
5705 bases(100 bases per row)
TCCACCGTGACGCGCGTGTCCTCGATCAAGTGCTGCGTCACTGGGAATCGGTCCACTTGCTCAGGCTAATTATAACATGGAGAAAACAAAGAGACGTCAG
TACGCGTCGATCTATATGATTGTGGAGAGGGAGTGTACGGGTACCTGGATGTGAAGATAGAACGGCAGGTTGGTCTCGGCCTCGATGGGTGTACGTATGT
GAGCGACGAGTGCCGCCACCGCCGCCTCCTCTCGCAGAGCGCGCTGCTCAATCGCGTCCCGCAGCGTCGCCTCCACGGATCGCATCGCGCGAGTGACGTG
GTCGCACGCACTTTGGACAGCTTCCTTGAGAAAGTGCACTCGCCGAACGAGCAGGTCGCGTTCGTACTGGACGGCTTTGTGGAAATTGCTGGTCGCGACG
TCGATCGTCTGGCGCGGCAGCAGCGCCACGGACGACACGGGCGTCGCTGTCGGTGTAGCTGCCGGCGAGGCGCCGGTTTTCCCAGTGGCCTTTCCGTGAG
GGGCGGTAGGCTGAGCTGGTGGCGCAGCGGGGACTGCGGGCTCGGCCGGCTTGGCGTTTGTGACGAGCTGCACGAGTGCGTCGCTCTTTTGCAGCACGAG
ATCGAACGAGAGGAGCAAGGTCTCAGGCGCGAGCGGGTCCCCTCCTCCAACCCCATCGTCGACTGCTGGCGTTGAAGCGAGCGGCGGCTTGCCCTTGACA
GCGGCACCACTGGGCTTGGCTGTGGAGCCCTTCCCAGTTGCAGCCCCTGGTGTCGGTACGCCCACTGCCCCTGCGACTGCGTCTTCACTGGTGTCCGCAA
ACACTCTGAGTGTGAGCTCGGCCAGCACGTGAGGATGGGTTTTCAGTGCGTCGTTCACCGCCGTGAGCTGCAAGGGCTCATCGCTCGCGGCTGCAAACGC
ATCAACCAGCAGCTGCAACGACCCACGGAAGCGATCGCACTCGGCCTGCAGCATGCGCTGGTACACGACCGCGATCCACTGACAGGTGTCCTCAAGCCAG
CCGTCGCCCACGATCTCCCTCAGCACGTCGTCGCTCTCGAGCTTCTTGGTCGTCGTGGTCGCACATAGCGCTTCCTGCAGCACGTCCACGCGCGCGTGGA
GCTCGCATTTTGTCGCCTCGTCGAACCGCATGTCCTCCAGCACGGCATTGAACTGCGTTTGGAAAGTGTCCACAATCTGCTGTTTGGCGTCGACGCGTCG
GAGAAACCTGCAGACCGTGGCCACGACCCAGAGCACTCGCTGGTCAACGAGGTCGCGCTGCTGCCGCTGCAGCCNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCTGTTTCATGGTCTGCGTGTACTCGGATTCGATCGCCTCCCAGAGCGACGCCAGCACACGCGCCAATGACGGCACCAGCTTGGCCGAGTAGACGGT
CTGCGCGTGCCGCACTTTCAAACTCTCATCGCACCGCCAGTCGCGTGCATCCACCAGCACCTGCTCCACGAATTTCTTGGCCGACTCGACTGCGCCCCGC
AGCTCGGCAATGTCTTCTTTCTTGGCCTTGTTGTCTTCGGCATGCTGGACGCTCTCCTTAGCCCTCGCGACCTCATCCTGTGCCGCGCGCAGACGTGTCT
TGAGATCTGTGAGCCTCTCCTGCCGGACTTCTTCTTCCTGCATCGCAATAGCCTCTTCCCGTTCCTTTTCTCGCCCGTGTTCAATAGCCGCCATGCGCTG
TTGGTCAACGAAGGCCTCGACATGGGCCACGAGTCGCTCGTGGGTCGCGTCAGCGGTCAGCGCGCGCGTGATCGCGACGCTCACGCCCTGCTGGCACTCG
GTCGTGGCGATCTCACGCAGAGTATCAAACCGCCGGAACCAGCTCTTGGCATCGGCCTCTAGATCCTGGGTCGACAGACACTGCAACGACAGCAGTGTCG
ACGCATTGCTCGTGGCGTTGACGTGCTGGAGGCGGTGGCGATCGGTGGCGTCCACCGGTGGCGGCGCGAACAGCAAGTGGTACGTCTGCTCATGAGTCGC
TGAGTCTTCCAGTGTTCCGAGGCATCGCTCCAGCACCGAAGCCTCGCCGCAGTCGAGGTAGAAGACGAGGTCGAGACCAGACTTGCCGTGGAGTAACGAC
TTGGGCAACGGCGGCTTAGCACACCCTGGGGCGAGGAGCGATGCGTAATCAAACGGCGAGAGGATCTGCGAGGGCTCGACGAACGCTGTCAAGTGTTCTT
CGAGGCTTTGCGCGTGTGCCAGCGTAGACGGCAAATCGTACAGCACCCAGCGATTACGGTGCTGCGGATCGAGCTGCTCAATCGCCGCCAGAACGAGACG
GCTGTATATGCTCGGAGGAATCTGGTCGCCTCGAACGAGAGCGGTCTGAGCTTCTAGTCCCAGCTCAGACGGTTCTGAGAGAGCCTCGTGGAGTCGTTTC
TCGACCGAGAGAAGCGCGAGGTTGTACTTATCAGCGAGCCGTCGGGCCTGGGTCGTCTTGCCCGCAAACGGAGGTCCGACCAGCAAGATGCAGAGCCGCG
GAAGCAGTTCGATCGATTCTGGATCTGGCGCAATGGTCTCAGATGGTAATAAGCTCTCCGAGTCTGTTGTAGGTTCAGCTTCTCGCAGTGCGTCAATGAC
CGCAACGCCCGACGCCGTCTCCACATCATTCGACTCGGACTCCGTGGCCTCCGCTAGAGGCTCCTCTTCCACCGCAGGCGATGGAGGAGAATCTACCCCA
GCAGGAACAACGTCCTCTCGGTCGACCCTTCGTTCGCTTGGAACTGGCACGGGCGGTGGGTCGGCGTGGGCGAGCCATCGCAAGTACTTGACCGTCTCGC
CAAGCACGAACCGGTCCTCCACGATATCTACAGCTGCGACAAACTTCCAGTCGCAGGGCACCCACGGCGAGACACTGGAGCCTCTCGTGACGGCGCCGAC
ATAGTCGTGGTTGCTCGTTCCAAATGGCGGCAGGATAAACTGCTCTAGGTACGCGACCAGTTCGTGATGCAAGAGATTGTCTTCTCCTACGGAGCTCTCG
CTCAGTGCCGTCACACCGTGCTGAGCAAACTGGTAGCGCAGCTCGTTCCAGCTCGCGTCGGTCGGAAGAAACGCCGTGGCATCGCGTGAATGAATCGAGT
CTTCTCGCTTCCCAGCGACAACCATTGCCAAGGCGACAATCTCGTGAACCATGAGCCCGGCGACCAGCTGGTTCTCATGCTGCCGCGCAGCGTGGCAAGC
TCGCATGCGCTGGGATTTCTGACGCGCCAGAATCTCCCAGTCATCATTGTACTTGGCAAACAGAAGCTCTGCCACGGCCGTGTCGCGGTCCACGGCTTCC
TGAGCGTCCATCTCACGCCGGTTGGCGTACCGCTCTTCGCGCCGCACGCGGTTCTCGACCGCAATCTCTTTGTACACGAGAATCTTGGCCATTTCACGGG
TGCACTCGGCTTCGCGGTGGGTCGCTCGCCCCATGAGACTCTCGAGGCCACGCACCATGCGGCTCGCGTTGGTGTCGCTCTGTGTGTGGAGAGCGTCCTA
TAAGAACCGTTTTCGCCGCCGCTCGAATTGGTCCCGGCGTCTCTCGCGCTGGTGTCGCTGGTCGCGGATTGTCGCCGTCGTAGCCACGTGTTCGGCCGTG
GGCTCGCTCCCCAATGTGATAGGCTTGACGGGGTCCCCCAGGCCCGGTTCCAGCAAGGCCAATTGACGCGCGAGCGTCGTGGTCAGCGACCTCAGTCCGT
AACCAAGCGACTTGCGCGTGCTGCTACCGCCCGAAGGTCCTGCCACTGGTGATGCACGTCGCTATAGACACACATGCACACGCAAAGGGTTTGTTTGCGC
GAGTAGACGAGCAGTAACATGAGCCCAACGACTCACCTCTACCTCGTCGAGGTCTCTCTCCACAGTCCGCCGTAGGCTGAAGGTCTCGGTCTGTTGGCGT
CGCATCTTGTCGACCAGAAGCTGCTGGTAAAAGATCGCCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGT
CCAGTGCCGTCTTGATATACTGCGAGTGGAGAAACGCCTGGTGGAGCCTCTCGGCCTTGGTCAACTCGAGCTGCTCGCGAATTTGTGCTTGCTCCTTGCG
GTACGCGAGCATCCCCTGTCGCTCGACTTCGATCGCGTCGCTAGTAGTAATATCATAAATGATGGATATGAGTATTCTTCCGGCGGCATATTACTACTTC
TCCCCCCAAGAGCGTACCGCTCACGCTGGAGTGCGCTGAGCGACTTGACTTGGCGCCGCACAGAGTGCTCAAAGAAGTAGTGGTGGGCCGCGTCATAGCT
GGGCTTGGCGAGTGTCGGCGGGACGTTGTGGAGCGGCCGCACGTTGAAGCGTTCCTCGGAGCGTAGCGAGACCACCGGTGCGCGCGCCACGCGCTCAGCG
GCGATCTTGATCTGGTAGAGCAGGTTCGCGGCGGCACCGCTCTTGCCGTTCATGATCGCGGTCGCGATCTTCGAGTCAAAGCGGATGTGGAGGCGGCGCA
GTGTCGGCTCGAGCAGGCAAAAGTTGATGATCTTGGCGTCGGCGATCTTGCTGTCCATAAAGTCGCTGAGGTTGTGCTGCTGGTTGAGCCGCTGGAGAAT
CTCGCCGAGCAGGTACCCGCTCGCAAAGTCGTCTTCGACATTCGAGACAAACGCCGAGAGCTGGAGATCATTGTTGAGCCAGTGGAGCAGGAGATCCGAC
ATGGAGACAGCGAGACGCGGCCTCTGAGAGCTGCGAGCGATGCCTTGAGAAAGAACACACACCGGCGAAGCCGACCTAGAGAGCAGGTACGATTGCAGAG
GCCGCAGGCGCACAGGGAAGCGGCGATACCCTCGGGTGATGGCCCTAGAGTCGGGCGGTAGGTAGCCATTGCTGCGAGGCGATCCTGAAAGGACACTGCA
GCTCTGTATGCGCTGGAATTATACGGCCCTAGAATGTTGGTCATGAGCTGTTGATGGGCCACTGAGTCACTCAGTGGACAAGCAGCGGATCCTTTGGGTG
TGAGATGGCCGTTGGATTCCGTTGGATTCTCCAAGGGCCACTCCCACCCACTTCGTGTTCTATCCAAAGTCTGGACCCAACTTGAGTGGGATGGAGAGAG
AGGAGGAAGTCCAAGCGCTGGATAGCTGCAATGATTCCTTCGGGCAAGCAGATCCCCCCANNNNNNNNNNTTTCCAAGCGCTGGAAAGCTGCAATGATTC
ATTCGGGCAAGCAGATCCCCCCACCGACCCCATTCGCCCTCAACTCACGTTTCCCATCCTTCAGTTCCGCAAACCTCCATTCGTTATGGAGAGATTTTCC
ATTCTCCGCCTATCAGGCCAGGAGTCCATTCACGCCTCCTACATGATTGAGATTTACTTACCTAAACAGGGATTTGCTGAGGGTTCCAACGGCGAGACAG
CTATAAAAATCCAGAGATTTACTCTCAAAATCCAGAATTTGTCCCCAAAATCCAGAAATGTTTAGTTTATGCACAAAAAGGGAGGGTTGACAGCAAATAC
TGCCCAAGCTCAAAACCTTTTTACCCTGTGCGCATGGAGAGCAAGTTTTAACCCTAGTCCTCGGCCTTCGGCCTGCGGAGCCAAGCAGGATTGACAAGGC
CAAATCGAGCGGAGCTCGATTTGGTAGCCGAGCGAGCCCGTTTAAGCTGTTACTAAAGTGCGGGGAGGGATGACCTACCTTCTGATTTTGGTGACTTTCC
TCTAG