Description :
From Genome Similarity Track
Location :
Scaffold_1489:1201- 3813
Sequence
2612 bases(100 bases per row)
CCTTCATGATGAATCCCAGAGCAACACCATGTTGCTCTGTCGGCGATAGCGTACGCAGCATCGCAGCTACTGCCGCTTCTCCAATGACTGTTGACAGTCG
TTGGAGTGCCTCCCACTCTGGATCCGACAGGTGGAGGCAGTCAGCGCGTGCAACATGAGTTGCAGGCGAGGTGGAGCTTTCCATGGGCACCTCCGCGCTC
ATGAAAAGGTTCTCGGCTCCTCGTTCGTACAGCTCCGTACGAACGTTCAGGTAGTCGATCGTTGGACGGACTACAAAGTGCTACCAGGTGTAGTGGGCCT
ACCTTGGCTCACTACTACGGCTTACACGTATGCGCAAGTGTATGAGGAAGCGTGGGTTTCTTTTACTTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTTCAACCGAGCTAGGTAGCTCGTGCTGCAGGTATGGCTTCAGCCTTCCGACGTAGAACGTTGGATGGAGGCGCATACTAGATGGTATGTC
CAGTGTGTAGGCGTTGCCGTGCCGTGCCAGCACAGTGAACGGTCCGATGAAGCGCGGAGCGAACTTGCTCGCCCCGAAGTCGGAAACGGCATGTTTAGGC
AGGTTTTGAGTAGCTAACAAGACTAATGAACCCTTCTCGAATTCATTAGTGTTGCCCCTGCCAACATTGTCTGCGTTCAACTTCTGTCGGTCGACAGAAG
CTGCAATAGCGTCCTGGACAAACCGAATGACGGCTTGTCTGCGCTGTACGAAGTGAATTGCGTCCGAGCTGAACTCGTTCAGCTCGCTTCCAGCAGTAGG
CCCTGCCTCTGCGTTGGTCTTCGTGGTGTTTGTGCCCTGCACAGACCCGTTCTTCTTCTTCTTTTTGCTCTTGTCGGCGTCTGTGCCCTGCACAAACGCG
CGGTTCTCGGCTTTGCTTTGTGTCGTTGCGGCTGACACTGTACAAGTGTTAGAGGCATTCTGCGGCTGCTGTGTTGGAGTCGTAGATCCCCCCCCACTTA
AGGAAGGAGCCACCATCCCGAGTAGACTCGGGACGCGTGGGTGCCTGATGGCATTCACGTAGAACGGTGTATGCCCGGTCGAGGCATGCACCGAGTTGTT
GATGGCGAACTCCGCCATCGGCAGGCACTCGCTCCAGTGTTGGAACGAGTGAGCGTAGCTCTTAAGCACGTCTACGAGCACGCGGTTCACGCGCTCGGTC
TGCCCGTCCGTCTGCGGATGGTCCGCAGTCGACATCGAAAGTTGCCTCCCAAGAAGTGTAAACACTTCTTGCCAAAGGTGTGCAGTGAAGCGCGGGTCTC
GATCCGACACAATGTCGATCGGTATGCCATGGTGTTTGAACACCATGTCAACGAACAGACGCGCCGTCTGTTTCGCAGTCACTTCAGCGGGTACTGCAGC
AAGATGTACCATCTTGCTGAAGCGGTCAACAAAGACCACAACGCCCGTGTTCCCCTGGCTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGACATGGAC
TGCCAACACTCCCGTGGAGTTGGTAGTGACTGCAAGGGAGCCTGCGCGAAAGGCGCAGGCTTCACACGTTGACAAACCTCGCAAGCACGGACGTACTTGC
GCACCCATTTGT