Description :
From Genome Similarity Track
Location :
Scaffold_2577:1201- 2575
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2577-snap-gene-0.1Gene of unknown function

Sequence
1374 bases(100 bases per row)
CCTCATGCCGAGATCGCGCGCTCCTCTAGAAAGGCAATCGCACCTTTCTCTGCTGTCTCGCCAAGTGACATCGCCACATCACGGTACGTTGCGTCGCTTT
CATGGAGTGCAAAGCTTCGAAAGAACAGCTTCATATGAGCGATGATCATCTTCGCGTCTGACTTGCGCTGCTTCTCGCCTTGTGCATCCCACAGACGTGG
CTCCCTGCAGTACCAGTCGTACCAAGTGGCGCTCAGCGCCGCCGCCGCTGGCCGCTGTCGCCGCTTAGCCGGTGTGGTTTCGTCGCTGCGCGCTAGTGTA
GCTCTCTTGCTCCCTGGGCGCGCGCCATCGCCTACCAGCGCCTCGAGCGCATCTAAGCGCTTGTCCTGGCGCTTCGCGAGCCCTATCAGGTGGTCGATAA
CAGTGGCTTGATGCCGAATGACCTTTTGCTCCTCAGTCTCCTCTTTTGTTTCGCCTTCCCCATCGCGTCGCGCCTCTTCTTGAGCAGGTGAAGCTCGCGA
CGCAACGATGTGAGACGACCATGCCAGCAAATCGGCGAGCGAGCACTGTGCATCGAGCGCACATTGATCGATGTGCTGAGCGACAGGGCTGCGCGGGTGC
TCCTGCTTCAACTGCGGGTAGTGTTGCAGCACGTGCGCGGTGAGAACGTCCAGCACGCGCCCCGAGACGCAGAAGCGCGAAGAGGACATCTTCCGGCAGG
TCGCGAAGAGGCGCTCTTGTACCGCGGCGATCTGCCCGCGCGTTTGGGCGTCGAACGCCGCGAGACCGCCAAGAGGTACGTATTCATTCGGCCGCCACCC
GCTTAGCACCTTGGCGACCTTGTGGTCTTCTGCGCGCGTGTTGAACACGTAGTTAAACGCTTTGTTGATTGTGCTCACGTTCCAGGCGCCCCTATCAAAG
ATCCAGCGGTCGGTGAGACCCGACGAGCCGTTCGCGTGCTGTGCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGATAGGGGTCGAGGAGGAGGCGG
TATTGGGCGCGAGCGCGGTCGCCGGGGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGCCTGCGCAGGGAGGTTACTGAT
CAGGTCGGCTGACGGCACTGTCTGTGTTGCCAAGGCGAGCGCGATAGCTAGGAGCGGGCAGGTGGCATAGTCAGCGTCAGGATAGAGAGAGAGCCCTTGC
TCCTCGCTTGTTTTTATGCGTATAAAGCGAGCAAAAAACACGTCTTCTGCATCCACAGACACACTTTGCTTGCG