Description :
From Genome Similarity Track
Location :
Scaffold_112:120052- 121288
Sequence
1236 bases(100 bases per row)
ACGAACAATGCCGGATATTGTCCCTTGGAATGTCGCCTTGAAGAGACCGAACTCGCGCTTTGCCTTGTCTGCCAGCTGCGACTGTGTGAGAGCGGCATTT
GCGTCATGCCACTGGCAAACCTTTTTCTTCTGTTCATACGTCAAGTTTCCAACCTGTTTAAACGCGACGGCATCGTTGTTGCGTGGCGAAGGCGAGTGAA
GAAATGCTATAAGTGGAATTGTGCTGGAATGAGCTGCTGAACACGAATTCGGGCTCCTTTGCTAAATTTGAGGTCTACAAATGACTAAAGGGCGTTAACT
CTAGAATTTGATTCTCCTACTATACATGATACGATTTTGTTCCACGGGTCACATCAAATTTGGCGGGTTTAACTGTAATTTATATTTCGTGGCTACAATA
TGGTAGCGGTAGTGTTCAACGTCTATAGTTTTTCATATATCTTATCAGTGGTTTATATTTTATATATTCCACATTATTTAGAATGATTTTTAGTTCACCA
TCTTGTGCTGTATTTGTACATATTCCGCATTATGTTTAAATTATCTCAATTTAGATTTATTTAATTTAAAATATCGTAATCGATGCATGATTAGTTTAAT
ACAATTTTCTGAGCTGTGCTTCGGTGAATATTTATGTTTGTGGAAGAAGTAATAGTGATGGTGTCGGTGGCCGTAGTATTTGTGCTTGTGAATTTAGTGG
AAATCTTTATGAATAAACCTCCATCCCGTATCGTCATATCTCCAATTTTGGCTAGAGCTTATATCCTACAGCTAGCAGTTATCGAATGAGCTCTTTTGGA
TGCTTGTCAAGAAGTCCCATTGGACGTTATGACTTTAGGGAGGACAACCTATCGGATAAGTTTTGCATATTCGAACAAAAGCTAACCTGATTTCTCAGGT
CCTGCTGATCACGACGGCATTGATGTGCTGACATGGACACGACCCGAGCACGTGCAAGCTGCCAGTATCATGTATGTGCTGATGATGCGTACAGATGCAA
TAATAGGATAGCCATGTACAATGACGACACGACACGATGCGTTGCCTTTGTCTTTGTCTCACCGAAGTATCCACGCGTGTGTAGCGTCACAGGTCCGACT
TCAGCTGTTAGTGCTTAGAGCACGCCATTACACTTTCACGCGGCTGATGTAGGTCATACGATAAGCTTGTTGTACAAAGTGGACGCGCCCCCCTACATTT
CCATGTTGTACTCGTCGCTCTAGCATTCGCTCTGTC