Description :
From Genome Similarity Track
Location :
Scaffold_4:1200517- 1202828
Sequence
2311 bases(100 bases per row)
ACCTTGGTGTAGACACACCAAAGGCTACATACATTTACGACCACCACGGCGGGTGGTCCATAGAGACTTATGATTCTTATTGGCTGAGAGCAGCATCTCT
TAGCCAATGAGCGACATGCATAGCATTGGAATTCTGCCAACCAGCCGTTGGCAGATTCCTATCTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAA
ACAAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAGTTAA
ACTAAGCGACGCTTCCTCACATACACGCGCACAGGTGTAAGCTAAAGTAGTGAGCCAAAGTAGGCCCACTACACCTGGTAGCACTTCGTAGTCCGTCCAA
CGACCGACTACCTGAGTTCGTACGTCATCGCACGAACGCGGAACTGAGAACCTTCCCATGGATACAGAGGTGCCCATGGAAAACTCCACTACGCCTGCAA
CTCACGTTGCACGCGCTGACTGTCCCCACCTGTCGGACCCAGAGTGGGAAGCTCTCCAACGACTGTCAACAGTAATTGGTGAGGCGGCTGTAGCTACGAT
GCTGCGTACGCTAACGCCGACAGAGCAACATGGTGTTGCTCTGGGATTCATCATGAGGGAGCAGCGAGATGCTGCTTCGTCTACCACGGTGTCGTCGGGG
ACGACACCGCGCGCGCAATCGCTGAAGCTCAGCGTGAGCAATTACGTTGGAAGAGAGGGCGAGCCTCTCCTCCGTTGGCTTGTCGAACTTGACACTGCCA
TTGCGGCTCGACGCATCGTCGACCCGTTGTCGAAGGTCACGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGAAGTTGGGCGTATGGACGCCGAGTCTC
TGATCCTACGTGCTTCAGCACGTACGAGGGTTTCAAGGAGGAGCTCAGGCAAGCGTTTGAGCCACCGCGAAACGAGTTCCGGTCGAGGGCGGAGTTCCTC
GACCTGCAGCAGGGCAAGCATGATGTCCATGCTTACGCTCAGAGAGCACGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGGCGACCAAGG
TCGTCACGTTCATGAAGGGGCTGAGAGATGGGCCTGTGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATTACTCTTGCAATGCA
GGAGGAGTTTAGCCTGCGGCAGGCTAAGCTGCATGCACATGTGCCGAGGCCACAGCCACGCCCGGTAGTGAGGACGGGAGGCCCAGAACCCATGGACCTC
TCGAGTGCTGCAACTGCTGGGCCCCAGCAGTCGCAGGGAAACAATGTGCGATGCTACCGTTGCGGTAGAGTCGGTCACTTTGCTCGGGAGTGCACGGCTC
CCGTGCACCAGCAGGGTGGCTATCGCGGCGGTGCCGGGCACCGTCGCAACCAAACAAAAAACGCTGGACGCCAGTAGGCGCGGGGCGCCCTACTGGTAAT
GCAGTTCCGCGTGTCGACCTTGGACACGCGACACTAAGGACTGCAGCCCCCAGTGAGGTTCATTCTCACTGCAAGAACCAAGATGACAAGCCTGACCTTG
TCATCCTGAATGTGAACTCGATGAGAGCAAGCGGCTCTCTCCGTGCTTTGGTAGATTCTGGCGCGTCGGAGAACTTTGTTCGACTGCGAAGTCTATCAAG
GCTTGACTTCGAGGATTTAAAGATATCTCGAAGTATGTTGAAGGTACGACTGGCAACGGGTGCCGTCGTGAAGACCGAGAAGCGCATGGTACGCGTGCGC
TTCACGTATGAAGATCAAGAGTTTGTCGAGACCTTTACCGTCCTGGATCTGGACGATAAGTTTGACATTGTATTGGGCATGCCATGGCTTGCACGGCATG
ATCCGGGCATCGATTGGGAGAAGCGCACCCTCGTGCGCTTCGGTCGCGACAGCGGAACAGTGAGCGATGGCCCTGTTGCCGCTACGCACGCATCGACAGG
TGCGCGCGACTCCCCACTCGAGCCAGCGCCTAATGCCGCTGTCCCGGAGCGCCCTGGGTGCGCGCGAGCACGCGGGCAAGAGCAGCAAGCGTCGGCGTCG
CCGCCGACGGCTGAAGGAGAAAATGTGTTGATCTCGGAGGCTGACACCCGCTTTTCAGCGAATCTGGAAGAGTCTCCGGCCTCATGGGGCACGGATGATG
CAGGCGAGTTTCACGCCTCAGCCGTGGAGGCTGACGCAAATTTGATTGGATCCGTTTTGGCCAATAATAAGAGCCAAGGTGACGTAACGCCGTCTACTCC
GGGAGTCGATG