Description :
From Genome Similarity Track
Location :
contig_44:120016- 121390
Transcript NameFunction/comments
g7940.t1programmed cell death protein, putative

Sequence
1374 bases(100 bases per row)
TCCGTCCAACCGACCGGTTTTGAATGACAACGACAGCGGCCTGCAAACAACTTCTCAAATCAGCGAAAGCAAAACATTGTGTAGCACCCGACGACAGGGT
TTGCTTCAGTTGGCCCCCCATTCGGGCTTGCTCACATTGGCGGCGTGAAAGCTTACTATTGTAGTGTATCAAAAGTCTTGCAGCAAGACTCTTGCTACAT
GCGGATATCGGCCAGGCGGCAGATCTGCCAGAAAAGGAAACTCCACACGTCAACTGTCGTTAATAACGACTCGTTACATGTCAAGGCGACAACTTGCGCA
GCTTAAACATACTCGCACCAAATCTCAGGCCCATCTCGGGTCCTGAGGGATCGTTGCTGTTGCCACCACTACTTTTCGCATCACAATGCACATGCAAGCG
TGAGCACTTCACCGCAGGCAACCTGCACGTCACTCTTTCGAGAATAGTAACTATTGAAGTAAACCTCGACATACAAAAACCAAGTCCGCTTATTTATAGC
TCGAGGGGGTTTGTTCAGTATCTTAGCACCCGCTCAAGAAGCAAGCAGCAGCAAGCCTTTAGGAAGGACAGCAGAGCAGTCCGACGCCAGCTAACTCCCT
GTCGTCGCCTCCTCTCCCTCGCCCTCCCCCGTCCCGCAGTTCTCCACCATGTCCGCCGCTCCCGAAGGTAGACACCGTCATCCCTAATTTACCGCGCAAC
GTTTTATCTAACCGTCATAAACTATTGTCACGCACCCAGAGCCCGTGACCACCATGGAGGAAGCTATGGAGCAGGCAACCTCGACCGCGACCCCCGCGGC
CTCGACCGGCGGCTCCGGCGGTGGCGACAAGCCACTGGCGCCCCGCAAGGAGCGCAGCAAGTCGCGCGACGCCGGCAAGCGCATGGGCGGCGGCCAGAAG
GTCCTGGCAGGTGACGGAGATCCCGAGCGCTGTGCCATCCGACGAGCACGACCCGAACTACGACAGCGAAGCGGATGAGGATGTGGTGCTCGTGTCCACC
GTTGCCGGGTCCCCCAAGAAGACGACGACGACGCTCGAGCCGGACGAGCTGGCGGCCAAGGAGCTGGCGCTCAACCCGCCGCCCGAGACGAAGAAGCGCA
TCATCGAGATCCTGGACGAGTATTTCACGAGCGGAGACGCCGACGAGGTGCTGAGCTCGCTCAACGACCTGGACGAGCCCGAGTTCCACTACGAAGTGGT
CAAGCGCGCCATCACCATGGCCATGGACAAGAACGACAAGGAGCGCGAGCTAGCGTCGCGTCTGCTCTCGGCGCTGTATCTGGACGGACTCACGGCCGGA
CAGGTGCTCATGGGCTTCCGTCGCGTGCTGCTGCTAGCTGGCGACTTGCAGATTGACATCCCCACGGCCAAGAA