Description :
From Genome Similarity Track
Location :
Scaffold_13:1200142- 1207780
Sequence
7638 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
ACTACCTGAATCCTCTGTGGTCTCATCGAGTGAGCCAAGATGGATCGTACGGAGTTCCCCATCTGAACGACTCGCAGTACGAGTCCGTTCGTAAGATGGC
AGGCATCTTTGGGACAGATGCCCTGCGTAGCTTAGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCATTCGACACCTACGAGCGAGGGCTC
ATCGCCCACGTTCAAGGGCTGCAGGCCACTGCGGCCGCGCCGAAGCCGGTGCAACCGAAGCCCCTGCGGCTGAAGGTTCACCCCTTCGAAGGGAAGGAAG
GAGAAAACCTTCACTTCTGGGTTCGAGAGATTGAGCTCGCGATGGACGCGGCTCTCGTCTCGGACGAGCGACTCCGTGTCGCCTTTGCGCTCTCCAACCT
TAGTGGTCGCGCTAGAGTTGGGCGTATACGCGCGAAGCGACGACGCCTGGATGCTTCGCATCATGGTCCCAGCTGTGCGAGCAGCTGCGGGCCGCGTTTC
TTCCGGCGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCCTGCAAACAAGGAAGGCGCGAGCTGCATGAGTACATCCAGGAGATGCGAGTGCTCAC
TGCCTCTTTGGTGGGGAACCCCCTGCCTGAACACATCAAGGTGACCGTGTTCATGGACGGTCTGCGTGTCGGTCCTGCCCGCGCGCAACTGTTCCGTGTG
CAAGCAAACACTATGGAGGAGGCGATTCAGATCGCCCTCCAGGAGGAGTACAACCACAAGCAGGCTCGTACCCCCGCCACAGTATGGCAGAGCAACCCTG
CCTCTGGCGGTGCGCCTAATGGTAAGTCCGGCAATGGAGCGATCAACGGGCCGGTTCCCATGGATCTGGGCATGGCCGAGCAGAGCGACATTCGCTGCTA
CGGCTGTGGCAAGCTTGGGCACATGAAACGTGCTTGTCCCGCGGGAGGACTGAAGAAGAAGTTCTCTTCGAAGCCCTTTGGCTCTAGGGGTCGCTGGCAG
AAGCCGCGCCCCAGGAACCAGGGGAACGCCGGGCACCTGTAGGGGCGGGGCGCCCTACTGGGGAAACACTAAGTCTTCATGAGGGGCGTGCGGGTGGCGC
ACGCCATGGGGACTTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGTGGGCTGCTTGTGGTGCACGCGAGTGTACCGGGATACGAT
CATCCCTTGAGAATCTTGATCGACTCTGGGGCGTCCAAGAACTTTGCGCGCCGCCAGACTGTCGCACGCAATCGCGACAAGTACGCCGATGCGCTACGAA
GCAGCAAAGGCAACGGGCTGGTCTCGGTAAGACTGGCCGTCGGTACGGTGGTAGAAGTACCTCGGGTCCACATGGACCTCACTGTCAAGTTCGAGGACTT
CGACAGCACGGAGCCGTTCTTGGTCCTAGACATGGACAAGTACGACTTGATCCTTGGCATGCCGTGGCTGGAGAAACACGAGCCTTGGATCGACTGGCGC
GGCAAGACCATCGGGGCCAGCCGTCCCCCACGCTCTGACAGAGCTTTGGTGAGTCATGTTCCCACCTCTGGCAGCAGCTGGGGCGCCCGCGAGGGCCGCC
AGGGCGCAGCAGCGTCTAATGATTTCTTGGGGTCCGTCGAGACTGACGACGACTCCGACCGGGCCGGACAAGGCCTGAGAGTGGAGGTGCCGGACAGCAC
CTACCAGGTGGGTAACGTAGGTCCACACGCGGGTAACGAAGTACCGCAGGCAGCAAGGGCTGCTGGAGAAGGCGCCGCTGGCGCTGGCGTGGGTAACCAA
GTTCCACGCGAGGTCACTCAGACCGTAACGGATGAGGAAGGCACTGCAGGTGCTTCCGATGTGGGTAACATAGTTCCACAGGAGGTCACTCAGACCATAA
CCGATGCGGGAGTCGCTGGAAGCGCTCCTGGTGTGGGTAACCAAGTTCCACACGGCGAGGTGGATAACATAGTTCCACCCAGCAAGGCGGGTAACCAAGT
TCCGCTCAAGGACAAGGCGGGTAACGTAGTTCCGCACGAGATCGAGAAGATCGGTGGTGCCGTCAAGGCGGCGCCACGAGACGAAGACACCCGAGGGTCA
CGTCCTAAGCCGGGCCTAGTCGTGTGGCCGACGACGCCAGTCGCCAGCGTCCAGCCAAGGCTCCAGCCGCCGAAGAGTGTTATCACATCTTCGACGGCGT
GACCGGTAGTCGGGTCAAGACAGGAGCTGTCGAGCTTACAGCTCTGCCCGAGGTTTCAGAGTTGCTGAACCTTGAGGAGCTCGCTATGGAGGACTTCTTG
GCCGAGCTAAAGGCCGGGGAGATCGCAGAGTTGGTTCTCCTCCGACCGGAGTCCACGTCGGCCGAGTTGAACTCGTCCTCGGTCATGGACCAGGCAGTCC
TGGAGGAGTTCCAGAGACAGCGCGCGTCGCGCATGGGCTCTGAGATTCTTAAGAACCCCCGGGACCCGGTGTACCCCTTGGTGAAGGCGTTTGAGGACGT
GGTGTCCAAGGATCCACCGTCCAATCTCCCTCCGGACAGGGGAATCAGGCACGAGATCGATCTCGTGCTGGGCACGAAGTACTGTGTCACGAGGCAATGG
CCTCTTCCCCGGGAGCAGTGTGAAGTCATTGATGCCTTCTTTGCCGCCAAGGCGAAAGCAGGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGACGCCTA
CCTTCTGTGTTCGCAAACCGAACGGAAAGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCGACAGTGCCTGCGCAGACACCGATCCCGCGCAA
GGACGTGTTGCTCAACAACATACGCTGTATAGCGCGCTGGACCTGGTGGACGAATACTACCAGATCCTGATGCGCGAGAGGGACATCCCATTCACGGCTG
TGAGCACGCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTCTAACGCCCCGGCAACGTTCAATCGCTTGGTCACACAACTGTTCCG
ACCTTTGCGTGCGTTCACACAGACGTACTTTGACGACATCTTCGTCCACAGCCGTGCCGAGGCAGGCCAGACGGCCATGGAGGTGCATCTCCAGCACCTT
CGATGTGTGTTCGAAGTCATGCGGGCGAACAAGCTGTACGCCAACATCGACAAGTGTGTGTTCGCAGCTGAGGAGATCAAGGTCCTGGGCTGCTTCGTCA
GCAGCGCCGGGGTCTGGGCGGACCCGGAGAAGGTGAAAACCATCGCGGCTTGGCCGCCACCTCGGTCACAGAAGGACCTACGACAGTGGTTGGGCCTCGC
CAACTACCTGCACAAGTATAGTGCAGGCTACGCCGAGCTGGCACGGCCCTTGTCGGATCTCCTGAAGAACGATGTCGACTGGCGCTGGGAGCGTCGCCAT
CCATCAAGATGCTTTTAACGACATCAAAGCGAGCTTACAGCGCGCGCCAGTCCTGGCATTGCCGGACGAGACGAAGCCTTTTAGCGTAGTCTGTGATGCG
TCTGACTACGCAATTGGCTGTGCGCTATTGCAGGCCGACGATGAAGGCCGCGAACGGGCCATCTCGTTCCAGTCCAGGCAGCTCAAGGCAGCCGAACGGA
ACTATCCAGTCCACGACAAGGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCCGAGTGCACCTCGTGGGCTCGACGCCCTTTGTCGTTTATACAGA
CCACGCGTCCTTGCGGACTGCCGTCAACACGCCGCATCTCTCACAGCGGATGGCGCGTTGCCTGTCATTCTTCGCGGAATACAACTTCCGTGTCGAGTAC
AAGCTGGGCAAGTTGAACGTGCTTGCCGACGCGCTGTCGCGCCGACCCGACTACGAGCTTGCTCATATTAGTCGGGTCACGACGGATCTGTATGATCGCA
TCAGGCTGGGGTACCGAGACGATGCCAGTCTCGAACCTCTTGTACGGTTCTTGGCCGCTGGCTCGGAAGCCAAGGCCGAGTGGCTCACGCCCCGACAACG
TGCAAGGCTGCACCGCTATGAGTGGGCTGATGGCTTGCTCCACTATAGGGTCGAGCCCGAGGATCCTCCCCGTATTGTCGTGCCCAACGACGAGAATATC
AAGTACGACATCCTGATGGAGGCGCACGACGCTCCATCCGGTGGCCATCTCGGCCGTGAGAAGACGTACGCGTCTGTCTCGCAGATGTTTTGGTGGCGTC
ACATGTACAAGTGGGTCGCCACCTACGTCCGTACGTGCGAGACGTGCCAGCGCGTGAAGCCTGCCGGTCACGCCTCAGCACCATTGCAAAGCCTGCCGGT
CCCAGCGGACTGCTGGAAGTCGATGAGTCTCGACTTTGTCTTCGGACTTCCGGCCGATGACCGTGGCAACACTGGTGTTGTTGCCTTCGTGTGCCGTCTG
AGCAAGATGGTCCACTTTGCTCCAGTTCGTGACACCGTCACTGGCGACGAGGTCGCTCGCCTGTTCATGGACTGTGTCTTCTGACACCACGGTCTGCCCG
AGACCATTGTCTCTGATCGAGACCCGCGGTTCACCGCTACGTTCTGGTAGACGCTGTTTCGCCTTCTCAGCACACGAATGTCGATGTCGACGGCGGACCA
CCCGCCAGACGGAGCGCGTCAATCGCGTGCTCGAAGACACGCTCCGCAGTATCTGCGCGGAGATGCCCCGCTCTTGGGCTGATCGCTTGCCCATGGTTGA
GTTCGCACTCAACAATGCGGTACATGCATCGACGGGCTTTACGCCCTTTTACCTAAACGGGTTGCGCCACCCTCAGGTGTCGCTCACATTACGAGGCAGT
ACCGGGGCTTCGGTCCTAAGTGGGGGAGAGGCTCGGAAAACCTTTTCCTCCCAAGTCTCGGACGTGAGTCCAGCCACCTTGCGGAAGCAACTGTCCTCGT
TTGCCGAAGACAGGCTAAACATAATCAGCAGGGTGCGAGACACCATGGCGCAAGCCCAAGATAAACAGAAGGAGTACTCTGACCGAAATGGAAGAGGAAA
CATGAACGTGTTTAAGGTTGGGGATTTAGTTCTCCTAGATACTAGAAACCTACCGCTAAACACTGTTAGCTCGGTCGAGAGCAACAAGCTGAAGCCCCGC
TTCATTGGACCCTTCACGGTCCTCAGCCGGCATGCCGCGGCGTACACCATAGACTTGCCCAAGTCGATGACGACTCACCCGACGTTTTACGTGGGTCGGC
TTAAGAGGTACCATGACCCTCTGGCTCTGGCTGCCCCGCAGGAAGCGGTGGGTGGCCCGGTGGAGAAGAGCGCAGCTCCTCGTAGCGCGGCGTCGAGTCA
CGGTAAGGCGCCTGATACGCGCGCTGGTCGTAAGACGGCGCGGCGTACATCGGAGCAGCATACGCAGGGGCCCCGTACGAGCCCTGGCCAAACGGGGCCT
GATACGAGTGGGGCTGCTGCTGCTCCGGATACGGCGCGTGGCCATGAAGCTCGGCCCGAAGGCCAGCGAGCTGGTTTCGCAGCGAGCCGTAAGACGACAG
GTCGGCTCGACGATCCACATGGCCATGGAGACTGCGAGGTTCTTGATAGAGCGAGGCAACATCCACACGGAGCCGCTCCACGGCACCAGGCTTACCAGCA
CGAGCGGCAGCCTCGCCACCAAGGCCGACGCCAAGCGCGATCTCGAGGACGTACACACGGTCCCGGAGAAGACGAATCTCCTCTTGCTGCAGGGCCACCA
CCTGACTCGGGGCCCCAGTATACGGCTGCGTCGCCTCAGGCTCGTAGCCATGGCCGTGCGAGGCCACCGCCGGCCCTCCTTGATCGTAATGGGCAGATCC
ACTACCACGTGGAACGAGTCGTCCGGGAGCGGCGGCTCCATGGCAAGCGCCAGCTGCTCGTGAAGTGGAGGGGTTACCCTGAGTCGGATAACTCGTGGGA
GCCCGTTGAGCAGCTCCAGGCAGACTGCCCGAAGGCTGTTGCGATATGGGACGAGAAGCAGCGGCAGCTTCGTAAGTAGTCCTTGGCTTCTTGGCCGGTA
CCCGGGGCACGGTAGCAGACGTAGTCGCACCACGCCCACGCTCTTCACGAGCTTTGGCTCTCGCCTCTTGCTTCAGCTCGTCCATTTTCGAGTGGAGCTT
GCGCTTGCTCACGAGTTGAGCGAACTCGATGCGGAGCTCGCGCACGTCCAGGATTGCGGACAGAGTGCGATCCTCACGGAGTTCTTTGAACTCTTGGTCG
GAATACCCTTTGCGCTGGACGTAGCGCCAGAAGAGGTCTTCCACCTCGCTCCAGGTCATGTTGTCATTCGGCTTGACCCAGTGGAAACCCCACACAGGAT
GGAGTCCACCCTTGTCCTCCGGCTTCTTGCGAAGCGTGGTGAACTCCTTCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACACCGGGCGACTTCAACGTC
GCCAAGAAAGAGTGGCTCTTTCTCAACAAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCCGCCGATAAGGCCACGAGGAGCCGAGAGCTTCTCCAAC
AGCGCTGGCGCACCAGTGCCAGGCTCGGGTGGGAAGTAGCCCTGCGGGTACGTGGCATCCCCGCCTGAAGAAGACTCGATGGCAGTCGTGGCAGTCGACT
GCCTGGCATACGCACCCGAGCTAGCAGCGTGGTATTGCTGCTGCTGCTCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGTGGACGGCACCCTCCTCATC
CTCAGACTCCGAGTCGATGAACAGCTTGGAGCTGGAGCCGCGAGGCGACCTGAAAGCTGAACGCTTCTTCGCCTTGGCCTCGGCGGCCTTCGCAGCGGCA
GCCGCTTTCGACGCTTGGGCACGCTCACGACCTTGTGCCAGCGTCAGATGCTTGGATGCCAGCACCTCCTTGGGCTTGGAGCCCGCGTCGCTCGGCGACT
TCTCGGCCACGACCCCAGCGTCGGCCATGGCGACTTCGTCGTGCGACTGCTTGCTGTCGCCGGCGTCCTCCGCCTCCTTCCCTGACGAGGCCTTTGCGTC
GGCCGAGGCGTTGGTCATGTCGCCTGCCGCCAGCTCCGTGCCTTCGGCAGCGTGCGTGCTGCCCTCCGAGACGTTCTCGTCGTCGGGTGAACTCTCACCG
GAGTACTGGACCATCGTGCAGTCAAAGACGGCGGCTTCCCAGTCGCGAGCCGGGCTTTTATGGCCCCGAGGACTCTCCTCCTTGCCTTGCGCGGCGTCAG
GAGACTTGCTCCGAGCCCCGGCCTGACGGCCACTCTCCGGCGTGCTGCTACGAGAGCGCACCACCTCCTCGGCCGCCTTCGTGGCCTCCATCAGCGCGGA
CGACTCGTTCTTGGCCTTGGCCGCCCTGGTCTTCGGCCCTACGGCCGGCGGTTTCGGAGGTGCTTTCGCACTGCGCGCACTGCGCTTTGGAGGCATGCTT
CCGGTCGACGTGGAGACCCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGGAATACCCTTTGCGC