Description :
From Genome Similarity Track
Location :
Scaffold_42:12000- 13606
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_42-snap-gene-0.25Transmembrane protein 160
Pytap_DAOMBR444maker-pag1_scaffold_42-snap-gene-0.39NADH dehydrogenase

Sequence
1606 bases(100 bases per row)
GCATCAGAGCGCACGCATGCGACCAACAGCCGGTTGTCGCTCACGAaGAACGCGCTGGTATGACTCCTGTCTCTTTGACTTTGTCTAGTAGGTCTAGTTG
AACTGACCATGGTCTCTGTGATAGATTCTGCGTTtCAGCAACGAGAACTCGTACCTGAACTGGGCTCGTAATGGTGTCCTGTCTTCGGCCGTCGGAGTAG
CCATGTACGCGCAGGAGCACCATCGTGGTGCCCAGCTGAGTGGTGCCGGCCTGTTGCTGCTTGGgTTTGGTTACATTGGCGTTGGCACTGCCAAGTATAT
TTATTACATCTTGCGCTTCCGCCAAGTCATGGAGCTCTCATGGGCGAGCGTCATCGGAACGTCCTCGCACGCATCGGCTGCTCTCATCATCTGGCTAaCA
GCGACCGCATCCTTCTTGGTAGGCCCTGGTCTCCGTCGGACACACGTACGAGCGTATCTCTGACCCTGCTATTCTTCTACAGGAAAGTGTGCCACTGGAA
CTTGAtGCGATGCTGCTGACAGAGCCCATCATTGACTTCCTCCcATTCCGCATTCGTCAGGGTCTCATCGAGACCTACAGTCTTTACCTGGACGACCTGG
AGCATCACACAGACGAGCAAGAGCGTGTCCTGCGTGCGATCCGTGGTGAGAACTATGAACCACGCTCtGCGCCACCTGCTCTCCCTGTCGAGGCACCAGT
GCAGACaGGAAGCTAATGATTATTCATGCCACAACTGCGTGAGAGTACTGCTTGAGATGGACGACGTGTCAATAaGGGGgCgTGAGTCTCGCAATtGTTC
ACATTTGTAGCATTTTTCTCTTtCTCcGGGTTGCTTGTGCTACATGAGGACTCGTttATGCCAACGTACATTGCATTACGGTTCCTGCATCGCGGCatGG
TCGCACGCGCTCATGTTTGgCTGCTTCCCATGCCACTCTGCTTCTTTGACACTTGCACAGGGCCGTCGAGCATCAAGTATATTTAAGCGATCTCCTCACG
CGAGTCGTCCTTGATGGCCTCCTCGAGCGGCACGTCGAAGTCTGGGTTACGGCGAATCGTCTTGCCGTCCCACGTCAGGTTGATCGGTTCGTACGCCTCC
TCACCGAGGACGGCATCGATGATCGGCGCCGCAACGAGCACGTCGCTCTCTGGGGACTTTGGCAGCGTCTGGCCGTACTCCACGATGCCCTTGAGCACAT
TGAGGATCTCATCCTCGCTCTTGTTGTCCACGAAGATCTGCTTCTCCTTGCCCCAGTCTGATCCCCCccAAaTGTCAGCTCTCGAATATGCACCCCCACA
AGAAAAGAAAAGAAACGTCTACGCACCAAAGCGGGCATACACGAACGGCTTCATCTCCTCGGCTTCTCGGTACACGAAGGGCGTGCGTGGGTTCAGCATC
TTGAGCTCCGCATAGTTGTTGCGAAAGAACGTGCTACACAGAATCGCCACGACACAccGTGGGCGTCGTCAGTCGCGGTGCACAGCGAAATTACCACTGG
AATATCCTAGCGGACGTACCGGAGACCCTGGCTGTGCTGCGAGGTGTCGCATGCAACGAAACGCAGCTCCTGGACCGCGCGGGAGATCTGTGCTCGCCAG
CTCATG