Description :
From Genome Similarity Track
Location :
Scaffold_2042:120- 2721
Sequence
2601 bases(100 bases per row)
CCAGTCACCTTTGTCAGCCCGGACACTGGAAGCCGAATGAACTGAACTACGGGAAAGAGATACTTGCGCTCCTGCGCGTGTTGGATCTAAATTATAACCT
GCTAGTGGGAAGATCCATCCGGATCCTGACTCGACACTACACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTGCAAGGACGTTTGGGACAGTGGGCAGCT
TTACTCTCACTTGGACGCTGGAGATGGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGAGAGTCTTGGCCGCGAGACATCACACTTCGAATTAAGATGA
ATGAGGGCGCTGACTAGAATCGCCCCTAAGAAAGAGGCCAAAAGCCGATTCCAGATTCCAGTTCCCCGACGTTACAGGGTGAATGAGAATCTATACGTCC
TGAATTTTCGATAGATACCGCTCGTGTACGAACGCGGGGGGAGGGGCCTCACAGTGCAATACTTTGGAGATTTTCCCGCCGGGGTGGTAATTTGTACGGC
CCAGATCCACTTACGCGGAAGGCCTCACCGTCAATGAAGCGGAGTATAACGGACTCCTTCTGGGTTTGGATTTACTAAAGGGACAAGATCCAAAGCGGCT
GGTAATTTGTGGGGATTCAAATTTGGTAATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATC
CACCTGCGTGGTTGGTTGGATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCGGATAGTTTGGCCAGTGCCGCTTTACGGAATCAATGTG
GTGTCGAAGTGGAGAGAGAGGCCCGAGCATCATGATCTCGTTACGTTGAACCGACTAGACGAAGTGGTGGTAGTTGGATCCGGGAAAAGGACAGTCCAGG
TGATGGCGGTCACTAGGTCCAGAGGAAGGATTGGATCCAGCCCCCAGATTCTCGAGGAAACATTTGTGAGGGGAGTCCGCATTGAGCGGATCCGCAAAGC
ACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAGGATGCCAAATCCTACAGTATTATCGCT
ACGGATTACGCGGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAGGATCGGGATGGATTGATGAGACTGGTGATGCCGG
AAACCTTACAACAGGATGTCCTACACCACTATGACGCTAGTTTAGAAGGTGGACATCAGGGTATCGGTCGGACATACCAACGGATCCGGGAATGTTTCCA
CTGGAGGGGACTATTCAAGAGCGTACAACGATATGTCGGTGAATGTGTGGATTGTGAAACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTTATCTGGG
AATGTCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAAATCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGG
ATCTGTTTACCGGATACGTGATAGCCAAAGCTAGTGCGTCTAGAACTGCGCAAACCATTGCCGAGTCGTACGAGGAGTGCGTTTTCCGAAGATTTGGGGC
TAGTGAGATGATTAGACATGATCGGGAGCCAGGCTTTATGTCGGATTTCTTTCGAGCTTTCAACCGGATCCTGGGGCAGAGACAGCGGGCAACCATGTCA
TATCGTCCCCAAGCTAACGGGTCGGCCGAGCGCATGGTGCAGACGATCACGAGGGCACTTAAGATGTATGTCCAGGATTTGGATCAGAGGGACTGGGATG
AGTACGCAGAACGACTCCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACCCCATTTTACTTGGTACAAGGGTGGGATCCCAAATCCAC
CCTAGAAGCGGCCATTCCAGTATGTAGCTCCAAGAAGAGAAACCGAGATCCAAGGCGATGGCGATATTAAGTCCAGAAATACTACCGGCAAGCCAGATCC
CAAGTGAACGAACGGCTGCGGAGTGCGATACAAAATCGAGCGGATCGACATAACGAAGACGCCCGTCCGCATCAAATCCAAGTGGGATCGCAGGTGTGGC
TTTATTTGGATCGAGTGAAAGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCATGGACCGTTCCGGGTGAGCGAAAAGATAGGAGAACATGCGGTAAA
GCTGGAAACGGCAGGTACCGAATATCGCTTGTTCCCTGTAGTACACGTATCCAAGCTGAAGCTGGTCAAAGAATATCCAGATCGGCCGCAAACCCGTCTT
TCGGTGGATGGATCCGACCGGGTAGACTTCGACGATGTCCTCCTACCGGAAGATAGTTGGAATGTGGACCTCGAGGCCGACGAGTTCGAAGTCGAGAAGA
TCACTGACATGAGGTCAGGGAAGCGAACTAGATACGGACGGATTACCGTGCATTTCTGGTGCATTGGCGTGGATATGACGAACCCAGTTGGGAAGACGAG
GCAGATCTGAACTGTGGAGCATTACTCTATGATTTGTTGCGGGATCGTACGAATCGTAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGAAG
G