Description :
From Genome Similarity Track
Location :
Scaffold_1888:120- 1277
Sequence
1157 bases(100 bases per row)
CCAGCGCGCAATGCGACGCGAAATTGTCTTCTACTTGAAAACTGTTTCAAGCGAGCGGTGGTCTGTCTCAACTACGAATGGTTTGTCCAGTAGATACAGT
CTCCACAAACGAAGCCCAAATTAAATCGCCAATAGCTCCTTCTCGCGAATGGAGTATTTTTTTCTCGGCGTCTTTATACTTTCTGCCACCGAACGCTATC
GGGCGCTCAACTACTGCATCACCCCTGACCTCCTCCTGAAACAGGATGCCGCCAACAGCGTGGTCACTAGCATCCATGCGCAGTCCAAAAGGTTTATTGA
AGTCAGGGACTGCGACTACTGGCGTTGCAGCAATCTTTTCCTTCAGCGATATGAAGTGTGCTCGCAGCGCGTCACTCCAGCGAATTACTCGCTTCACCGG
CCCTTTCAACATGTCAAACAATGGTCCAGCATCGGACGCAAAGTCCCGACAAAATCTCTGGACGTAGACTGCAGTACCCAGGAACGACTGCAGTTCGCTC
CGGGTACGAGGTAAGGGCCAGTCACGAAGTATCTCCACTTTCTTGGGATCGATTCGAACACCACTACGTCCCACGTAATCTCCTAGACAGGGAATTTCAT
CGACGCAGAAAACACATTTGCTAAGCTTCACGTAGAATTTGTGCTCTTCGAGTCTCGTCAGCACGCGGTCGAGAGCCTCCAAATGTATCCTCGGTGTACA
CATAGATATCATCGAAGTAGCACTGACAAATATCGATGAGGCCTCTCAAAATACGGCGAATGCCTTCGTTGAACGTGGCTGGAGCATTACAAAGACCCAT
CGCCAATACGAAATATTCAAAAGCTCCATCCGGTGTTTGAAAAGCTGTATACGGAATATCACAGTCTCTCATCCTGAACTGATAATACCCGCTCAGCAAG
TCCATACAGGAGTACCAGTACGCGCCCTGCATTTTCTCGATGATCGTATCCTTCCTGGGCATCGGCAACACACGGCGAATTGTGTGAGAATTCATTGCAC
GATAATCGTGTACTATTCTCCACCCAACAAGCTTTTTCACGCAAAAGGTTGGTGCTCCATGCGGAGACGTCGAAGGCCGAATCAATCCGGCAGCGCGCAA
TGCTTCGACCCAGTCCGTTATGACCTTCTCTTGGGCCGGTGACTGTCGCCACTGCCG