Description :
From Genome Similarity Track
Location :
Scaffold_1737:12- 3183
Sequence
3171 bases(100 bases per row)
GTAATCAGCGCTGAAGCCTGAGTCGAAGTAGCCTTTTTTTGCATAAGCTAATTTAATCCACCCTTCGTTACTTATATACGTCCTTTAACATTCTCTTGTG
ATTAAAAAGCTATGTCAGCGCCCTCCGACGTACACCTGGATCCCGGGCTGGATCCACCCTTACAGCGTACGCCTGGATTTGGGCTGGATCCACCCTTTCA
GCGTATGGTTCGAGCCCCCGAAACACTCGCGCTTGGTTCGAGACTCTTTGCACGTGCAACCTCACTTTTTATGCATAAACATTCACCTCTTCCTCCTGGT
CCACACCCCTCCTGTGGATCCTTCTTCTCTTTCTTTCCAATATAACCGGCTCACATCAGTGATCCTCCTCCTCCTGACCCACACCCTTCCGGTGGGTCCT
TCTTCATCCTCCCATCGACATGACCGACCCCACCCATGGATCCTCTCCCTACTCTTCTTCGTGAGACGCCGAATCGGTTCCGATTCGTACGATCCCGCAG
GAAATCACAGCGTAATGCTCCACAGCTCAGATTTGCCTCGTCTACCCAACTATGTTTGTCATATCCACGCCAATACACCAGAAATCCGCGGTAAATGCGT
CCATATCTGGTTCGCTTCCCTGACCTCATGTCGGAGATCTGGATATTCTTTGACCAACTTCTAACCGGCTCACATCAGTGATCGTCCTCCTCCTGACCCA
CACCCTTCCGGTGGGTCCTTCTTCATCCTCCCATCGACATGACCGACTCCCACCCATGGATCCTCTCCCTACTCTTCTTCGTGAGACGCCGAATCGGTTC
CGATTCGTACGATCCCGCAGGAAATCACAGCGTAATGCTCCACAGCTCAGATTTGCCTCGTCTACCCAACTATGTTTGTCATATCCACGCCAATACACCA
GAAATCCGCGGTAACTGCGTCCATATCTGGTTCGCTTCCCTGACCTCATGTCGGAGATCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACCA
CAGGGAACAGGCGGTATTCGGTACCTACCGTTTCCAGCTTTACCGCGTGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGGTGGGCTAA
TTTGCGGGCATACCCCTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATCCCACTTGGATTTGATGTGGACGGGCATCTTCGTTGTGTCGATCCGCT
CGACCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTCC
TCTTCTTGGTGCTGCAAACTGGGATGGCCGCTTCCAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGATGTATCACCCCGGATCCTGTCTTG
GGCGGTGTTCATCGCGAAGGGAAGCCGCTCTGCGTACTCATCCCAATCCTTCTGATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATTGTCTGC
ACCATGCGCTCGGCCGATCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAAGAAATCAGACA
TAAAGCCTGGCTCCCGATCATGTCTAATCATCTCGCTAGCTCCAAATCATCGGAAAACGCACTCCTCGTACGATTCAGCAATGGTTTGCGCAGTTCTAGA
CGTACTAGCTTTGGCTATCACGTATCCGGTAAACAAATCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCC
ATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACGCATTCAC
CGACATATCGTTGTACGCTCTTGAATAGTCCTCTCCAGTGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAGGCT
AGCATGGTAGTGGTGTAGGACACCCCTGTTGTCATGGTGTTCTGGTAATCACCCCTCTCCATTCATTCCCATCCCCGGTCCTCGCTGTAATTCTCTTTCT
TAGGGGGGGCAATAAAAGAGACAAGTCATTCCAATCACTGCGTAAATCGTAGCGATAATACTGTAGGATTTGGTATCCTCCCGACTCAGGTCTCGTACAT
CCCCCATCAGATACTTCTTTAGTCCCAAGATCCACGCTTCCTCGTTCTATGCTTTGAGGATCCGCTCAATGCGGACTCTCTTCACAAATGTTTCCTCGAG
GATCTGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTCCTTTTCCCGGATCCAACTACCACCACTTCGTCTAGTCGG
TTCAACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCAACACCACATTGATTCCGTAAAGCGGCACTGGCCAAACTATCTGCACTGGCATTCC
AATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGGATCATTACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAAT
CTCACCTCGCACCTGTCTGATCACCAAATTTGAATCTCCCACAAATCACCAGCCTTTTTGGATCTTGTCCTTTTGGTAGATCCAAACCCAGCAGGAGCCC
GTTATACTCCGCTTCATTGATGGTGAGGCCCTCCGCATAAGTGGATCTGGCCCGCACAGCTTCCCATCCGGGCAGTCTCCACAGTATTGCGCTGTATGCT
CCTCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCATCCACTTGTTTCGTCGGGATCGGGGTTTGGATCCGGCGTTTTG
GGCTCTTTCTTATGAGCGATCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGTGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCG
AACATTTCACGATCTCCAGTGTCCAAGGCGAGAGTAATGCTTCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCAGGCTAGCGTAGC
GTGTCGAGTCAGGATCCGGATGGGTCTTCCCACCAGCAGGTTGTAATTGAGATCCAACACGCGCAGGAGCG