Description :
From Genome Similarity Track
Location :
Scaffold_1478:12- 2820
Sequence
2808 bases(100 bases per row)
CATAAATAAACAGAGTTATATCTACTTATAAAAAAATAAGAGCGCTCTCAATCTCAGTGTGTACGACGTAACGGGCTCTCACCCCGATACACCTGTAGAC
TTGAGTCTGACCATGAAGAAGTTTGAGATGAACATGAACGAATCTCGGACGGCTCCAGTAGTTTCTCCGGAGCGTGCAGACTTCCCTCATATCACTACTG
TGGTACACCGCCTTGCGAAGGTGTCTGGTGTCGTAACGTCACTGCTGAGCACAGCGAAGCCCGAGCAACACCGTGCCGACATCAAATACTACATGGTCCG
CGAGCTCGCCCAAGCGAATCATCGAGTACAGACTCTATCGCGCACCTTCCTTTACGATGCAATTAAAATGGAGACGTCGACCTACTCCGGTGATGTTTCG
GATCGTCTCTCCCTTAACCGCTGGTTTAGGGAGATTGATATTGCGATAACATCAAGACTAATTGACGCTCCAACCGCCAAAGTCAATATGACGCTGGCTC
GGCATGTTGGTAAAGCCGAAGAAAGGGCTCTTGGGAAGCTCGTTGTAAATGAGTCGCCAGTTCCCACGCTGGACCATATCCAGCGCAATCTGTGACTGGC
GTTCAAGCCTCCACAAGATGAGTCACACCTGCGTGCAGACTTCTTTTTAGTTCGACAGGGCAAGTTATCGATGCGTGAATACGTGCAGAAAACACGACAC
CCTGCTTCGTTTATCATCACGCAGCCGATCGACTTGGCTTCACAAGTCTATGTCTTCGTCTCAGGTAAGTAAGAGGGAATGATGCGTTATTTCCACACAC
GTTCTGAGCCGTAGACGATGAGGGAGGCATTTGCCATTGTGCTTCGTTAAGATTACACGGTTGCGTCATCGTACTTGCACACAGCGTCGCAACGTCTGCG
TACGTCCGGCCCAGAGTCTATGTAAATTGATGCAATTGATGAATCGCCCGGTCACGACAAGCAATATAGCCGAGACGCTCGTAGTCAGAACACGATGAAG
TGTTTTCGGTGCGGCAAGACAGACCATCGTGCGGCCGTCTGCCGATCACCAGCGCCGGTGGTCATGAACACAGCTGTATCACGTAGAGATGCTGTGTCGT
CGATGGTCCTGCCAAAAAACGAGTGGTTTCAGTCAGCGCGGGGTGCCCTAGTGGCAGTAATGGAGCCGAGTACTCAGGTAGAAGCTCGGGCTCCTAGCCC
CAAAGTAATACATACTCACTTCGATGCCACCACCATGCGCGACGATTTGAGCCTGATTATTACCAGTCTCATCGTTGCTGGAGTGAAACGATCACTCTGA
GCGTTGTTGGATTCGGATGCATCCAACAAATTCTTTCGATCATCATGTTTGTCCCTTCTCCTGTCTACGATTACGGCTTGAGAAGGTCCAGGTGACATTG
TTGTCATACTTGCCGATGGACAACCACAGCGTGTCCCCGTAAAATAGTGGTTTTGACGAACCCAACGGTTTTTTAAGCAATGATAAATTTCTGGTGTATG
AGATGATCTATGCATTTGATTTTATCTTGGGGATACCGTGGCTGTCACAGTATCAGCCGAGGATAGATTGGCTATCTCGGTCCATGAAATGAAGAAGCGG
ATATGAAGTGATTGAAGTGTCCACTCACTTGTTGGTTGCGTCATCCGGTTGGCCTCACATCAGGATCGTGGACGAACTTGCTACGACCAGAAGTCAGCAT
AGAGAGAGCGATGGCACTCTGTGCTCGGTATGTTCTATCACACTGATAGATCCACAACATGAGGCTGTTACAAAGAAGTTCCCGCAAACACAGACAACGA
TTGAGCAGGGAATCCCAATTGACGAGGCGGTCGAGCAGAGGTTCCAGCAAGCATGGACATCGTTCTAACAGGGGTTCCTGATTCCTAACGAGGCGGTCCA
ACAGGGGTTCCCGCATACACGAAAATCGTTCGAACAGAGAATCCCGATTCCTAAATAGGCGGTCGAGCAGAGGCTCCCGCATATGCACGCATAGGCTGAG
CAGAGGCTCTCGATTGTTACAGAGGAGGTCGAGAATGAACTCTTGCATACATCTGAGGCGGTCGAAGACGATCTCCCGCCCCTAATCGACAAGAATGAGC
AGACGGTAAATCCGAAAGTGAACGACGTGGTGCAAAACAGAGCTTCTACGTCTATAGGGGGGGTATATCGTTTTATAGCGACAGCGTTGTGCCAGTCTCG
AACAGTGGCTCGAGACGCAAGAAAAATCGTAAGCTCAAGAAAGGAGCACGCCGATCGCCAAGACGACGAAGTTCTCGTCAAAGTGCTGACGAAGATGAGT
CGTAGTGGCGGAATCAGTTTGCGTGCTTGAATATGTGGAACAGTCTCCACATCGCGGCCGCTACCTTGATGTAGCGAGGCCCTCCATACACTGCTACAGA
GATTACATCTCTATCATCCCTACCATGGAAAGATTTCCTTCAAGACTTCAAGGCCGGTGGTATAGAGCAAGTTTGCATCGTTTCAGCCGCCAAAGCAGCT
AGTGAAGAAGATATAGAGGCTCTCCCAAAGAGCGCCGTGCTCAAAACAGCGCGCAGAGAACGTTTCATGGCACAGTCTTGGGAATCCCTTCGTGCTTCGG
GCAACCCTGTTTATGATATCTCTTGCGAGTATGCCGATATCTTTCAGGAGAAAATCCCCGCTGAACTTCCAGCGGATCGTGAAGTGCGGCACGAGATCAA
TCTCGTACCATGATTGAAGTATCACGTGACGCGGCAGTGGCTGTTACCGTGTGATCAAGTCATCACAATTGATAAACTGTTTTAGGGCTGCCGTAAGGCT
GGCCATGT