Description :
From Genome Similarity Track
Location :
Scaffold_1976:12- 2742
Transcript NameFunction/comments
Phyta_totarag13949hypothetical protein

Sequence
2730 bases(100 bases per row)
CCCGCTTGTataacttcgtaccttggtcgatcttgattgatggaactagatcgaccaggaaatgtccgcgtccacttcaccacagccGTCCCCTGCACGA
GTGACAGCCGTACAACGGTATTCGATCGATGCACCTTGGTCGACACTCTCTAACTTGCCAACTCGCAACCACGTCCGCGCCGCGCCGCCTTGTGCCATgt
cacctgcagctcctggtaCCCGACGTCCTCGCCGAGATCACGCGTCTCCTGGTAAGGCAACGTCGCCAGCCGCTACGTCTGCATCGCCGGGTGCTGCGAC
CGCACCTGcggctggtgctgctccCGCTGCGAATGCCGCGCCTCAATCTCCgtctgctgcggctgcgaaTGCGCCCCCGGCAACGTCGGCTTCGACTATC
GACCTCGATTCAGTTCCCGCCATTGATCTCGGTTCTGCGCATGCCGCTCCTGATCTGGCCACTGGGTTGCCTCTGTCACTGGCTGTTGAtcgcagctgct
tctgcaacTGCCGAAgagccttctgctgcttccgatgctgctgccgatgctgctgaagagtGACGCTCCCGGATGCCACGCCATCGTGTCCTGAGTGCGC
TCGCCACGCGTCGGCTCCAACAGTGCGCCTCGATCGGTCTCCTGTCAGTCTACGGCTCGCTTCAGGGCGTCTTGACTACCTTACAGGAAATCGAGATCGC
GGTGCGTCGAGAAcccgagttccagcagctgcaagaagaaCATGTCGATCTTCAGCGTGCACACATCTCGTCGCTTCAGCATGCTGGCGATCTTCACCGG
CAGATTAGCTacaccgccgccgctgctgtcccGTTCGTCCATTACTGCCAAGATCGGCACAATTCGCTGTTCAGCGCGCCCCAAGCGGCGCACTCCTAAC
TTGAGGAGCGCAACTTTGCCGTGGAACAGCTGGAGGGAGCGATCGAGTCGGTCCTCGCCTCCAACAAGGCGCACATCAAGTCTCAAGCAGCCTCTGCCTC
GACGATCCGTCACCTTCGGCGTCGTGTGGCAGCACTTGAGATCTTGACCACGAACCTGGAGGCTCAGCTCTCTGCCGTGACTTCCCATCCCGATCTTGGT
TCGCCTCCGCATCCTAGCCTcgcgcgtcgtcttcaagctcAGGATCAAGCCTTGTCTAGCGCTCTCCAAGATCACGAGGCCGCGCGGCAGCGATatgagg
cgctgctgcaatcgAAAAAGCCGTTGGAAGATGCGGTGGCTCAGCTCCGACGCCAGGTGGAGTCTCAAGATCGAAGGGTCACTCGGCTCCGTGAAGAGCG
CGATAGCTTTCAAGCTAAAAGCCCGGAGGCCCAAGCTTCGCAGGATGACGCCGCCTCCCGCCTCAGAGCAGAGACTGCTCGCTTGGAGAAGACTCGTGTC
GATCTCCAGTCGCAAAAGGCCCACATCTCCTCCATGCGGTCGACCATCTCTCGCTTAGAACAGCAGGTGGTGCGGTGGCGTGGGGCTCACGCCAAGGTCC
AGGAAGCCCTCGCTTCTCGAGATCAAGAGATCCATGATCTCTGCCAAGAGCGTGACGCCTTGCGCCGCGaccacgatctcctccatgGTCATTACGCGGA
CGTCCACGCGTGCTTCTCTGCCGTCGCGTCTGACATGGGGCAACCCGTATCAGCTCCTTCGCCGACCGTCCTCGGCCGGCGCAAACCGGATAACGAAGCC
GTCTCCAATCGTGCACGCAAGGTTCGCCGGACTTCGCCGGCATCTCCTCACTCCTCTCCTGCATGTTCGCGGTCTcccgctgcagctcattcaAGGTCac
gatctccgtcttctaGGTGCGTTGCGGTTCGTTCGAAGCCACGTGTCCTATCGTTGACTCGTTCACGATCTTCTTCGGCGGTTCGTTCCAAGTCAAGATC
TTCGTCTCCGGTGCGGACCCCCACTCGTTCAAGGCCGCGCCCCCTGTCGCCAACTTGCTCGcaatcttcgtcttcggccAGATCTCGATCACCATCGCGA
TCTCGAGGAACGTTCCTTTCGACTTGCCCTTCAACTGCGGACCTGGAGCATGGTGTCGATCTCGCGTTTGGTGACGTCGAAGTTCAATCATCGGGCAAGA
TCGCAGACACGGGTGAAACTCCCGCGTCAGCAGAAGGTCGAGCAGCGGTGAAAGATCAAGTCGATGATGATTCCGAAGATGAGAGCAGTCTGGGCGAGGA
TGATCCTGAGCTGTTGATGGCACTCTCTCGCTCTCGATCTGAGGGTCGTCGTGCCAGCTTATCTGACACGGGGTCGTCCACTCACACTGGTTCTGCCGGC
GATCTGGTCCCCGTAGAGAAtcccagcgacgacagctcttcCGGCAActcgcccccccccccagttCTGCGCCGAATTCTGATTCTGGCGAGGGTCGATC
AGCTGTTGTCGGCCCGTGTCCCAGATGTGAGATCGAATATTGATCTCGATTCTGGGGCTGCCGTGGAGGACGATCTCAGGGGTCTTTAGGGAACGGAAGA
GGAAGGTTTTCATCTACAACCTGCCGTCACGACCGTCCCGAGATCAGAGTGGATTCCCAGCAACATACAGCGTCTCTATCGAGCATCAGATGTCGGGCCT
TGGGATCAGGACGCCTTAGGTAGCCTGCGAGTTGCAGATATCGATGTCCCGAtcttgagcgagttgctAGTGAGCGTTTCCGAGTGGATGTTTCCAGATC
TTGACCCCGCAACTTGTCCACCTCCACCCA