Description :
From Genome Similarity Track
Location :
Scaffold_3336:12- 2572
Sequence
2560 bases(100 bases per row)
GCGATCCTGGTCAGCCGCTCATCCATCTTAGCTCGGGGGTGTGATGCTCGCGTCCAAGACTCCCAGGATCTCGTCCTCCCCTTCGAACATTTCACGATCT
CCAGCGCCCAAGGTGAAGTAAAGCTGCCCATTGACCCAACCCGTCCTTTGCAGACCGGCCGACTTGAACAACCAAGCTAGCGTAGAGAGTCGAGTCAAGA
TCCGGATGGATCTTCCCACCAGCAGGTTGTAATTGAGATCCAACACTCGTAGGAGCGCGAGTATCGCCTTCTCCACCGCTCCGCAATTAAGCTCATTCGG
CTTTAGCGTCCGGCTGACGAAGGTGACTGGATGGCAGATCCCCTCATGTACCTGTACCTGTGCTGCTGAGACTGCCCAGTCACTAGCATAAAGTATCACC
GTAGGTTGACGTTCCGGATCGAAATGGCGGAGGATGGGCGTCGTCGCGATCCTGTTCCTTAGCTCCACGAACGCGTGCTGAGCTCGGATCCACCGAGGTT
CCACCTTTCCCGAGTTCTGATCCGTCGTCTCTATCCTGATTGGATCCTCTTTCCTTTGGTCCCGGGGGGGGGGGGTCCAGCTCCTGTTCTAGGTCCTCTT
CTGGCATCGTACTACTTGGATCCCCTCGTTGATCCGACATCTCCAGGGCCAGAGCTTGTTGGACTTTGATCCGGACAGCTGGAGTGGTCATCGCAGCAAA
ATCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAGAAGGATTGCATCGCCCGTAACGACT
GTGGGAAGGACAAATCGACTAATGAAGACAGATCCTTAGGATTCGCCTCCAATCCCTCCTTGGACACCCGATGGCCTTAGTACTCCACCTTGCGCATCCC
CCAATATCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTTTCGCACAACTGATCCCACGATTCCGCCGGG
ATTAGAATGTCGTCGATGTAATATCTGCGTCCTAACACAGACGGGGTCCCAGGATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCCGTATGGCCTT
CCCCGGACCCACCCGTTTCGGGCTCCGGTATCCGGGTAAATCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCGAA
CGCCATCCGGTTCCACTCGAACAGGCCAAACGGTGTGATGAATGCGGATATTGCACGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATG
TCTAGAGAACAGTACCATAGTACTTTATCCAGATCTTCCAACAGCTCGTTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGACTGTTAACCAGCC
GGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACCGGAGATGCCCACGGGGACGTTGAGAAGCTGGTGATCTTGGCTTG
CAGCAGGCCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGTGCCACCTTCCGCACCCTTTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCG
CATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCGATCAACAGATGTCGACTTTCCCAGATCTTCTGACGTAGACGATCCACTTCCTTGG
GTTCGTTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCCGTGGTACCTCCGGGATCACCGCCATGCCTTCCCCAAGATCCTC
TGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGTTCATCTTCAGTCTTTGTCGGATCCACCCTTGGATCCAAGCATTGCGACTCTCCTTCAACCGTC
ATCCCTTCTGGCTTCGTGGGGTCGGGTATCCTGGTACTGGGGAAGCCACCTTTTGGATCGGCTTGATCCTCTGGTGGGCTTACCCACGATGGTTCCTGTT
TAGCTAGTGCGGCCACTGTCGACAAGGGTCCAGACACTTGGCCCCATGAAGAGTTAGGATCCACTCTGGGGTCAGCGGGATCTGGCGGTCCGGCTTCAGC
CCTCTGCGATTCTTCATCCACCAATCCTGCGTTATCTGGGGGACGACTCTGGGGATCATCCCCGGTCTTGGATCCAACCTCCATCGCTTGGATCTCGATC
CGACGATTTCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCCCCGCCGGGAGCTCCACCTCTCCGAGAGATT
CAATCTCGGTAGTCGCCTCGTACGCCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGC
CAACCATCGCCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGTCCCTGGATTACG
GTAGGTACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTAACC