Description :
From Genome Similarity Track
Location :
Scaffold_514:12- 2430
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_514-fgenesh-gene-0.0Conserved gene of unknown function
Pytap_DAOMBR444snap_masked-pag1_scaffold_514-abinit-gene-0.23Vesicle transport protein SFT2B
Pytap_DAOMBR444maker-pag1_scaffold_514-snap-gene-0.10Conserved hypothetical protein

Sequence
2418 bases(100 bases per row)
CACAGTGATGCTGACGGTCGTGTACACGGAGCTAGAGAaCTCGCTGCACGTGTTTGTGCTGCTATTTATCATCGTGGGTCTCACAGTGTCCATCAACTGG
TTCATCATtGAAGCCAACCGCCTCAaGgaGATGCAGCATATCGAGAACGTGAACTCTCAAGGCAGCAAATCGAAGCAACAAGCGGCGCGCGCGAAGACGG
ATTAAGTCcACAGGCGGACACGCACACAGAGGGATTTTGGAGGATGTAAGAAATGTACTGCACGATTCATACTACGCTCTCTAGAGGTCTTCATCAGTGG
CCATGCCACACGTTCTTTTGCAGCAATTGAGGAAGATCTGGCGGCCGTAAGGGACATAAGAGAGTGTGTACCAAACAAGCGCTGCAAACTGAAACAGCAC
CGACAGCATGACAAGGCCGAcGCGGTGGGGGAGgTGCGGTGAGAAGCAGAGGATGAGGGTAATGATAATGAACGAGAGGTATGTGATGGCCGAACCGCGG
CGTTTTtGGCGGAACATCGTCTCAATTTGCTTGCATGGCCCGACAAaGAACATTGACGACCcGAGCGATAGCAGGTTGCCAATGGTATAGGCCGTGGCGA
ACGGCCcTGGGTTCCCATGGACgAGCTTGGCGAGGCGAAAGGTCGAGCCGAGGGAGATGAGGAAGCCGAGCGCAAAGCACGTAAGACAGCCAATGACGCG
TTCCTGGTACGTGAgaCTGGGGCACAGCGCATAGGCCTCTTCCTTGAAGCTAGGCTCTCGCCCAGACTCGGGATCCAGCAGCTTCTGCTTCTGCTGGCGC
AGCTTGTCCATCATGGTGACTTCTCGACTGGGATTCTTCGACAGATACACcGgAGTCGGTGGCTTGACTGGATGGTGGCACGAGCCATTTCTTTAAGAAG
TACGCACAAGTCGGTTGCAGAATGCAGGtcAGGGTGCGTACTTAGTACTAAGTGCGCGTCCTTGCATGAACCTCCCCGCCATTTCCCCATTCGTGGTCGA
CATGGTGCTGAGCGGCACATGGACGGCGGCGGCGGCGCTGCAGGAGGCGCCCTTCGCGTGCTTCGAAGACGAGGAGATAGAGGCGTTGGGACATGGCCCG
CAGCACACGGCGACGCTAGgCGGAGGCGCCTCAGGACGCAGCCTGCCGACGCACGTGGTGACTATGCCGGCGGCCGCCAAGGCTCTGCCAGCGCGTAGTG
TGGCGCGATGTGAGTGCCTGAGAGGTGCAATAGGACGGAATATGAGGTGCTGAGAGTGTGTGTAAGTAGTGCGCTCGCTCGAGTGCTCGGGATCGGGCTC
CTTCTACTTCCAGagCGAGGCGCTTAAGCATCGCTTCGTGTGGTATGTTCATTAGAATCATGTTGAATGCCAGGAACCTGATCAACGCGTGTGTGGATGT
AGCTGGCGCATCACCAAGAACGTCATCATTGTGCGGGAGTGGAGTCTCCACGCGTCGCTCGAGGGCAACGGCCTGCGTCTGCAGCTGCCCGTGTCAGTCG
TGCCGACGGGCGTCTCCGTGTGCGAGTCGTGGGACGGCCACTCGGTTGTCATCAGCGTGCTTACTCATGCGGGTTCCATCCATCGCTTCgCGTTTCCTGT
GACACCCGTGGACTCGACTGGCCCGCGTAAGGGCGGACTGaCGCCGAGCATCTTCAAACGCCACCAGGACACCGCCGCAACCAGCGTGTTCCCTCGCGCG
CCTTCGTTCCGAGCCACCGCCGACGTTATCAGCTCGCTGCAGGCGGACGAAGCAATCACGACGGCGCTGTGGGTGAACGAGTACAACCTCATTGTGGCCA
CGGACGCAGGCCGCATCGTTGGCGTCAACTTCGGTCTCCCATCGTCGCCAGAACAGGTGCCTCAAGAGTTCcTCTTCAGTGACGAGTCGATGGTGCGCTG
GCTCTGGAACGGACTCGTGAAGAGCGGCAACCGCAAGCGCAATGCCACGGGCGACGACCTGCCATCCGACGCCATCGTCGCGATGGCATTTTtCCCTTtG
GAAGGCGACCAGCAGACTGAAAACGGCGATGACAGCGACGTCGAAGTGGCCGATGTGTGCATCCTCACGCTCTCCGCCGACTTCACACTGCGCGCGTGGT
CCTTCCGCAACCAGACGTGCCTCGGCAAGCAGTCGATTCGTGCTCTTGTGCGCTCGGCCGACCCGGACGATGATGACAGTCTCGAAGACGAAGACGACTC
AGCATCGTATGCAGTCCAGGCCAAGCTGGTCGCCATCCCAGCGTCGAGCAGTGGCGCATACCGGATTCTTGTGCACGTCGATTCCACGGAGGACTACCCA
CAACAGATTGTTCTTCTGCGCGGCGACATTGGCCCCAACTCGTCATCGGaGCTCTCCCTCGAAGTCGCGCGTGTGTTCGGCATAGGAAGCGGCAAGCAGC
GCCTCAAGTTCGTCGACT