Description :
From Genome Similarity Track
Location :
Scaffold_1797:12- 2294
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1797-snap-gene-0.1ATP-binding Cassette (ABC) Superfamily
Pytul_var.sporangiiferummaker-pug3_contig_1797-snap-gene-0.2Gene of unknown function

Sequence
2282 bases(100 bases per row)
TGGATTTACTGGTTGAGCCCCATGAGCTGGAGTATTCGTGCCATCGCAATCAATCAGTACCGCTCAGATGAGTTTGACGTGTGTATTTACAACGACATCA
ACTACTGCGAGCAGTTTGATGGGAAAACCATGGGCGAGTACTACTTAGGCCTTTTCGACATTTCGACAGAGAAGGAGTGGATCTTGTACGGCATCATTTA
CCTTGCCGCACTGTACTTCGTGTTCATGTCCTTTTCGTACTTCGTACTGGAATACAAGCGCTTTGAGAGTCCAGAAAACGTGAGCCTGACCAAGGTTGAC
GAAGACGACGGCAGCAGCTACGCACTGGCGACGACGCCAACGATGTCGTCCAACCTGAGATCATCCAACTCAAGTGGGGACCACGCTGTGAATGTGCATG
CAATGACCGATAAGAACTTTGTCCCTGTCAGCATTGCGTTCAAGGATTTGTGGTACACGGTGCCTTTGCCAAGCAATCCGAAGGAGTCGATCGATCTGCT
CAAAGGGATTACTGGGTATGCACTCCCAGGTACGATGACAGCATTGATGGGGTCTTCGGGTGCTGGTAAGACGACACTGATGGATGTGATCGCTGGTCGC
AAGACCGGCGGCAAGATCCAAGGCAAGATTTTGTTGAACGGCTATGAAGCGACCGACTTGGCCATCCGTCGTTCCACTGGCTACTGCGAACAAATGGACA
TTCACTCTGACGCGTCTACGATTCGCGAAGCGCTGACATTCAGCGCATTCCTCCGTCAAGACAGTAGTATGCCTAACAACAAGAAGTACGACTCGGTGAA
TGAAGCATTGGATTTACTCGATATGCATAACATCGCAGATCTGATCATTCGTGGCAGATCAGTAGAGCAGATGAAGCGGTTGACGATCGGCGTCGAGCTT
GCTGCTCAACCGAGTGTGTTGTTCCTGGATGAACCAACGAGTGGCCTCGATGCTCGCTCAGCCAAGCTGATCATGGATGGAGTTCGCAAAGTAGCAAACT
CGGGTCGCACCATCGTGTGCACGATCCACCAGCCTTCGTCAGAAGTCTTCTTCTTGTTTGATCAGCTGCTGTTGCTCAAGCGTGGCGGTGAGACGGTATT
CTTCGGCGAACTCGGCAAGGATTGTCGCAACTTGGTGGACTATTTCGAGGCGATTCCAGGAATCTCACCACTTCCAACGGGATACAATCCAGCGACGTGG
ATGCTCGAATGCATTGGTGCGGGTGTGAGCAATGAAGTTGTCAACGACACGGATTTTGTGCAAATTTTCAACCAAAGCGAACTGAAATCTGCATTAGATG
CTGAGATTGCGAGGCCTGGTGTTGGTCACATCGCACCGGATACGTCCAAGCTTCTCTTTTCGAACAAGCGTGCATCGGCTTCCACGACACAAATGAATCT
TCTGGTGACGCGTTTTTTCGACTTGTACTGGCGCACCCCAACGTACACCTTAACGCGATTCATCTTATCATTGATACTTGCGGTGTTATTCGGGTTGGTG
TTCGTGGATAATGAGTATGACTCCTACCAAGGTCTCAACTCGGGCGCTGGCATGATCAGTTTGTCCGTCGTCTTCAACGGGCTCATTTCTCTGAACAGCG
TCATTCCGGTGACGATCAAGGACCGTTCGCCATATTATCGAGAACGAGCATCGCAGACCTACAATGCGTTCTGGTACTTTATTGGCTCGACGTTGGCGGA
GATCCCGTACGTACTTCTGAGTGGGTTGATCTACACGGCCGTCTTCTATCCAATGGTTGGTTTCACGGGGTTCAGCACCAGTGTACTCTATTGGCTCAAC
ATGTCGTTGCTGATGCTGTACAACGCGTACTTGGGCCAGCTTCTCGCATTCGCGTTCCCGAGCGAAGAGCTCGCAATGGTCATGGCGATTTTAACCACCT
CGATCTTCTTGTTGTTCATGGGTTTCAGTCCGCCGACGAGCCAGCTCCCGTCCGGGTACAAGTGGCTCTACGACATTACGCCGCAAAAGTACTCGTATGC
GATCGCCGTGTCGCTTGTGTTTGGCGACTGCTCAAGCGATGCACGATACGATGCTGCACTCGGCCAATTTGTCGACGTGGGCTCTGAGCTTGGCTGCCAA
CCACTCCGAAACGCCCCGATTACCATGGATCAAGTCACTGTGAAGCAGTTCACTGAGGACGTCTTCGGCATGAAACACAGCAACATTGCTCGAGACTTTG
CCATTTTGATCGGTGTCACCTTGTTTTACCGCGTCTTGGCACTATTGGCGTTGCGTTTCATCAATCACCAGAAGAAGTAAGC