Description :
From Genome Similarity Track
Location :
Scaffold_3602:12- 2158
Sequence
2146 bases(100 bases per row)
ACCCCTGGTAAGGGATTTTAGCCGGGAAGAAAAGAGACATTAGAAGAGTGAAATCCCAGGGCAGGGTATTAGGCCTTAAATATCCATTACAGAGCCCTTC
ATTTGACACCCATAACACGCCAAGTGCCCTTCCTGCCCCTTCAAGAAACCGGAACTTCCATGGCCCGTACGAGCTCGAAGGAAGAGTGGGGAATTGCGGA
TTCTAGTGTGGGTAGTGATAACTGGATAATACATTGACCCAGTCCCTACAACCTAGTAAGCTTTCCCATACACGTGCAGATCCCGACAGGTTAACCGAAA
TTTACTACTTGGTCGGTTATACCGTAGAGAGCTCTCAACTCTCAAGATCCGGTCACAGGAGGCGGCAGGTACGACGCAAAGGAACGCAAAGACAAGGGAC
ACACCCGCAAGGCAACACTACGGCCAGATCCACGATCTAGGCCCAGAATCCATAAGCTCGAATATTCGCTTAGGATTCGGAACAATCCACGGACGCAGAG
TGAAGATTTTCCACTGCTGCTCCACCCCATCCCCACGTCTCGCCAAGCCACTCAAGCTTCACCACCACTTGGACTCTTCGGAAGTTACCGAGAGAGCAAG
ATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTA
AGTTGGATCTGGCAATCTCGTAGATTTTGCTGATCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTGTGGTGACTCGGGATTTCACCGTGAGTCCC
AAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAGAGGCGTCGTCGGAAGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATG
GAGTCTTGGGAGGAACTCTGTCGACGGAAGAGAGGTGGATCCGGATCCGGATCTAGAAGAAAAACCTCTCTATCCCCCCCAGGTCCCCTCGGGGACCCCT
GCGGATCTTGATGCAAGTCAAGATCCGCTAACAAAACACGGAAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACGCTGTACC
TAAGCCCAACATCGCTAGTCGAAGAAACGAGAAAGAAGACGAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCT
GGATCCAGGTCAAGCTGGTCAGACAAGAATCTCGAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGA
ATCCACGCCAGATCAAAGATCCAAGGGAACCGGTGAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAGGATCTATTACGTTTGCTTACGGA
GTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGGATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGGCCTCTTTGCCAGAGTTAAG
TCCATCACCGGAGAAAGGTCGCGCACTATGGATCCGGTGTCGTCGCCGAGGGTCAGCCAAGCTGCGTCCTCGAACTACAAATCCGCCGCTGAGGATGAGT
CAGACACGTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGAGCCGAGGACAGGAAGTCCCTGTGAG
CGCGAAGGCTCGGGATCCAGTAGGCCCCACGCGTGATCTGACACAATCCAGCCACGATCGAGCCAGATCCGGCAAGAAGCCAGTGGAATTATCGTCAGAT
CGGGCTCAAGGTAATCGCCTCACGGATCCGGTCTCGCCAGTGGACCAGACGGCCACAGGCACTTCCGACACTTCCTCGGGCACCCTGCAGCGACACTTAG
AAGCTGCGATGAGTCGTTTCCTGGCCGAACAGGGTATGAGAGCGCCCGTGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGC
GTCCGTGGAGGGAGACAACTCCCATGATAAGTTCGACCCAGATGATCTGGATGGCCCATCCACTTCGTCAGCAGTGGTAGCAACAGCCACAGCCGGGGCA
GGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGG