Description :
From Genome Similarity Track
Location :
Scaffold_612:12- 2152
Sequence
2140 bases(100 bases per row)
CATGTGATAGAGTCCACCTCTCCACATAGATTCTCCGACCTTTCTGTGTGCGACAGGCCATAGGAGAGTGGCGGATAGTACACGCTTCAACAAGCTGACT
GCTGCCAATGTACCGGCTCAAACAGCAATACCAAGGAAAGATGTCATCATAGATGGTATAGCTAAGAGTACCATCTTTTTATCCATGGATCCGATGGATG
GGTTCTATTAGATCCTTATTCGCGAAAGGCACATTCCCTATACTGCAGTGAGCACCACAAGCGATATGCTCTGGGAGTGGCTGGTGATGCCACAAGGATT
AATTAATGCCCCTGCCCTATTCAACAGATGTGTTTCAAATCTGTTGAGACCAGTAAGAGACTTTGCACCCAGTTACTTCGATGATGTGTTCGTCCATAGC
CCGGCTATGGATGGAAAGACGAATGTGGAAGTCCACCGACTCCACGTCCGGAATGTTCTTACACTGATGCGCGAGCATAAGTTGTACGCCAACCTCAAGA
AGCGTATATTTGGTGCTAGCGAAATACCACTTCTTGGGTGCATCGTGGGCAAGCATGGCGTCTGGCCCGATACAGAAAAGATCAAGGCGATCACCGACTG
GCCGGTGCCTACAGAAGTCAAGAGACTTCGAAAGCTCTTTGGCCTAGCGGCGTATTTGCATAAATATTCACGCAATTACGCCGAGATGACTGTTCATCTC
TCTCATCTATTGATAACGAACAAGAAGTGGGTATGGAGTGCTGATTTTTAATTTTCAGCGCTCCTTCGAAAGTATCAAGCAGAGCTTGATACGATCGCCA
GTTTTGTCGATTGCAGATCAAGACATATCATTCCACAAGTCGGTGACGCCAGTGACTTCGCAATCGGCTGTGCATTAATGCAGTACGATGCAGATGATGT
GGCGCGTGTCGTCTGTTACCAGACTCACCAGCTGCAACCAGCTGAACGCAACTACCCCTTCAGTGACAAATAACTCCTTGCCATGAAGTAAGCGCTGGTT
AAGCTTAGAGTCTATCTGCTAGGTGATAGACGCTTCATCGTTTTTACGGACCATGCGTCTTTACGCACGGCCGGAAACAGTCTACTCCTCTTGCAGTGGA
TGGCGAATGGCTGTCATTATTTGTGGAGTAAAACTTCTCCGTCGAGTACAGGCCAGGACGACTTAATGTCGTCGCTGACGCACGCTCGCGCCGGCCCTAT
TTCGATCCGGCTGCGCCACCCGACACTGGTACGACCACTGTCGCGGTACTGACTTCGAGTGTCCCGTCGTCAACCTTATTGGAAGACATAAGAAAGGTGT
ATGATCTGGAGATGGTGCGATTGACTTATCATCTTGCAACCATCCATGAAGAACCTCAAACAGTTGTCGTTAGTGTATCGATCCTCTACGGATGGATGTA
CAGTTCGCAACAACTTACTGAAATATCCAGCTGCTGCCGGCGACACGCCTCGTGTCGTCGTACCTGATAAGATGGTCTGCGGTTGCGCATCGTGGATGAG
CACCACGACGCACGTGTTGGTGGGAATCTGGTCGAGAGAAAACATATCTCACATTGAGCCGCGACTTCTACTGGCGCCTCCAGTATCAGTTCAGCGCAAG
TACTTTCGTGCTTGTGGGGCACGAAGTTTTTAAAAGGGTACAGTCTAGTCCTTCCCTTCGTGCCCCGTTGCAGCCTCTGCTCGTCCTAGCAGAGTGCTGG
AAATCCGTTTCCATGGACTTCGTCTTTTAATTCCCCGCAGACTCTCACAAGAACACTGGTATTCTTGTGTTCATTGACCGATTCAGCAAGATGGTACATC
TGGTTGCTGTACCTGAATCAATCAACGCATTGGCTTCTGTCCGTGTCGTTATCAACACGGTCTTTCACCTTCATGGGTTGCTTCGTGAACTCGTGTCCGA
TCGGGACCCGCGGTTCACAGCTGAGTTCTGGTGTTCCGTGTTCAAAACACTCGGAGTGCGCTTAAAGATGTCCACGTCTGACCATCCCGAAACAGATGGT
CAGACGGAATTAGCCAATCGTGTCCTCGTGGAGATCCTTCAAGGATTCGTCCCTTTACAAATTGGAGCGGATTCTGCCGATGGTGGAGCTCGCCATCAAC
AATTCAGTTTATTCGTCGACGACGCACACGCCGGTTTTCG