Description :
From Genome Similarity Track
Location :
Scaffold_3430:12- 1791
Transcript NameFunction/comments
Phyta_totarag15282hypothetical protein PHYSODRAFT_344705

Sequence
1779 bases(100 bases per row)
CCCTCGTactcctccttctcagcCGACTGGTTGGCGTCCAGCCAGTTAATGGTCTCCGTCACCTTGTCTTCGATACCCTTCTTGTCGGCCTCCGAGATCT
GGTCCTTAAGCTTCTCGTCGTTCGAGCTGTTACGGAGGTTGTACGCGTAGTTCTCCAGCGCGTTCTTCGCCTCGATGCGCACCTTgttggcctcgtcctc
cgacTTGTACTTCTCGGCCTCAGACACCATGCGGTCAATGTCAGCCTGCGACAGACGCCCCTTGTCGTTCGTGATCGTGATCTTGTTCTCCTTGCCCGTC
GACTTCTCCACGGCCGACACGTTCAGGATGCCGTTCGCATCAATGTCGAACGTCACGTCGATCTGCGGCACGCCGCGAGGCATGGGCGGGATGCCGTCCA
AGTTGAACTTGCCCAGCAGGTTGTTGTCACGTGTCATGGACCGCTCGCCCTCGAACACCTGAATGAGCACACCCGGCTGGTTGTCCGCGTACGTCGAGAA
CGTCTGCGACTTCTTGGTCGGCACCGTCGTGTTACGCGCGATCAGCGTGGTCATGACACCCCCGGCCGTCTCCAgacccagcgacagcggcgtcacatca
agcagcagcaggtcctgcagcttctccgacGAGTCGTTGCCGCTCAGGATGGCCGCCTGCACCGTGGCGCCGTACGCCACGGCCTCGTCCGGGTTGATCG
ACTTGTTGGGCTCCTTGCCGTTGAAGAAGTCtgacagcagctgctgcaccttggGAATACGGGTGGAGCCACcgaccagcaccacctcgtgcaCCTGGCT
CTTGGACAGCTTCgcgtcgcgcagcaccttctccacggGCTCCATTGTCTTGCGGAAGTAGTCGCCGCACATGTCCTCGAAACGCGCGCGCGTGatggtc
gagttgaagtcaaTGCCATCGAACAGCGAGTCGATCTCGATGTACGCctgcgccgacgacgacagtgtACGCTTCGCACGCTCGCAAGCAGTccgcagac
gacgaagagcacgCTGGTTCTCCGTGATGTCCTTGCGGTGTTTGCGCTTGAACTCCTGCGTGAAGTGGTCCACCAGACGGTTGTCGAAGTCCTCACCACC
CAGGTGCGTGTCACCAGCCGTCGCCTTCACCTCGAAGATGCCCTCCTCAatgctcagcagcgacacaTCGAAGGTACCGCCGCCCAGGTCGAAAATAAGC
ACGTTGCGCTCGCCGCCCTTCTTGTCCAGACCGTAAGCAATAGCAGCGGCTGTCGGCTCGTTGATGATACGCAGCACGTTCAGGCCAGCAATGGCACCAG
CGTCCTTGGTGGCCTGACGCTGCGAGTCGTTGAAGTAGGCCGGCACCGTGATCACGGCGTTCTTCACCTCCTTACCGATGAAGGCCTCGGCCACCTCGCG
CATCTTGATCAGCACCATGGACGAGATCTCCTCGGGCTGGAACGTCTTCGACTCGCCCTTGAACTGCACCGTGATCTGCGGCTTGTCGCCAGCGCCCGAC
GTCAGCTTGAACGGCCAGTGCTTGATGTCCGACTGGACGATCGGGTCCGAGAACTTGCGGCCGATGAggcgcttggcgtcgaacACCGTGTTGTGCGCGT
TCATGGCCACCTGGTTCTTGGCGGCATCACCGATCAGACGCTCGGTGTCCGTGAACGCCACGTACGATGGCGTGGTGCGGTTGCCCTGGTCGTTGGCGAT
GATCTCCACACGGTCGTTCTGCCACACGCCCACGCACGAGTAAGTCGTGCCGAGGTCAATGCCCACCGAGTATCCAGAC