Description :
From Genome Similarity Track
Location :
Scaffold_1163:12- 1495
Transcript NameFunction/comments
Phyke_g11908hypothetical protein PHYSODRAFT_517932

Sequence
1483 bases(100 bases per row)
ACCATGGCTCAAAAGGCTTtcttcacgatggaggacgccaagatggCGTTCAACCTGTTCTGCTGCGTCTACGGCATCGGCACGCTTGGTATGCCCGGCA
ACTTCTCCCGCGCCGGCCCTGTGATCGCCATCCTCGCCATGGCCTTCATGGCTTTCGCCAACATCTACGGCTCTGTGGCGATCTGTCGCGTGATGCTGCT
TGCGCCTACGTCTGTCAGGACGTACGGAGACCTCGGTGAGTGGGTCATGGGCAAGCCTGGTCGCTATCTCTGCGTCGCCGCTCAGATGGGCAACTGTCTG
CTGGTCCCGTGTGTGTTTCTGGTGTTGGGCGGCACGTTGCTAGATGGTCTCTTCCCAGACGCCTTCAGCACGACGACGTGGTCTATCCTGATGGCGATCA
CATGTTTGCCAGTGTGCCTGGTGCCGACTCTGaaagaaggtgctggtgccgcCTTCGCAGGCTGCATGGGCACGCTCATCGCCGATATTATCGGCGTAGG
CCTCGTGATGCACGGCATGCGCGGCCACCCTAGTATCCCAACGCCTGATCTCAATTTTAAGCAGGTGGTTGGTGCGTTTGGTAACCTTTCGCTCGCGTAC
GGCGCAGGCCTCGTGATCCCATCgttgcagcgtcagcacagCGACCCCACCCGCATGCCTCGCGTTGTGGGCGCTACAATTGCGTTcacatcttgctgct
tcctgGTATTGGCCACCACGGCTTACTCGTCGGTCGGCTGCCAGATCGCGGGCAACATCCTGTGGACGATTTACCCGGACTCGGAGACCGGTCTCACGAC
GCTGGGCTTCTCGTCGGACTGGGGTGCCGTCGTGCTCGCGTACTTGTGCATGCAAGTGCACATTACGATCGCGTTCTCAGTTCTTCTTAACCCAGCCTTC
TACATCACTGAGCGTATTATTCTGGGCATGCACAAGACTCCTGTCATCGATGTCGAGAACAACCTCCCAACCTACGCTGAAGTATCCACGCCGAGCGATG
CTGTCGAGGAGAAACAAGTGGTTTCACATACGTCGCAGCGCCGTTCGTTCATTTCTGCCACTGGTGACGAGCCTGACGCAGAGGCTGCTGAGTACCGCGG
CGCGAATGCCATCAAGTACATCACTCTCCGTATCGTGATTGTGGTGATCCTGGTGATTGCATCGATTGTGCTGAAGGACCACTTCTCCGACCTGGCTGAC
TTTGCCGGTGCATCGTGCATCACGCTACACTCCATTATCCTGCCGatcgtgttcttgctgaagaagaagtggaacGAGCTTCCGATGTGGGAGAAGGTTC
CGGCCCTGATTGTGACGGTGGTGTGTTTCTGCCTGGGCTGCTACGTGACGTACACGAACGGCGAGAACCTGTTCGCTCccagtgacgacgacacggCGTT
CCCGTTCTGTGCGCCCGAGTACGAGAACGAGGTGTACTACAACTACACTGCTGCCCACGAGAGCTAGACCTAGACTGGTTGAA