Description :
From Genome Similarity Track
Location :
Scaffold_4385:12- 1380
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_4385-fgenesh-gene-0.0Glycosyl hydrolases family 31 protein

Sequence
1368 bases(100 bases per row)
TGCTCCTGCTCGCTCTTGGCCAGGATCGCGCCCGCGAGCGCCTTCCGGTATCGTCCCCACGTGACGTCCTCGCGCAGGTCCTGCCGCACGTTGGCCTCGT
CGATTCGGGCCGCGAGCTCCACGGCCTCGGCCCGCAGCAGCGACTCGGTGAGCGAGTCCTTGAGCGCGCTTTGGCGGAAGTCGGCGCGCTCGACCCGGTA
GAGGATAGCGCTGGGCGAGGCTACGAGCACAGAGAAGACCGCGTTCGTGGCGCCCATGAGCACCTCGAACGAGCCAAAGTAGTGGCGACTGCCCACCGTG
CAGACCTCGACAAAGCTTTGCTCGAATGAGTGCTTGGATAGCGCGAAGCGCTTCACGAGACGGCACTCACCGTGCTTGACAAAGTAGAAATGGTCTAGTA
GAGCGTGAGTCGGGATTAGCTATCAAGGTCCTAGGATGGATGGATAACTTGAAGACTTACTTGCGAGGTCGCCCTCGGCCACGACAATGTCGTTGTACGA
GAGCGTAAGTTTCTCCATGCGGCCGCAGAGCTTGAGCGTCGAGTCCGTGTTCCAGTGGTCAAAACCTCGCGTGCCGGAGAGGAAGGTGATTTTCTCTCTG
CGTAAAACCTATGTTAGTCCAGCCCAGAGCCTAGGTACAGAAGACCTACTGGCACCCACCGGAGCTCGCGGCCTATGTTGCTGCTGCGCAGCTCGAGAAA
CGTCTCCTTGTCGATCTTCATGAGCAGCGTGCGCTCGCACGCGACGACCGAGGCTGTGCGGTGCTGTTCACTCAGCAACAGACCCACGTCCCCAAAGCAC
TCGAGCGCCTTGAGCGTACGCACCACGTAGCTCGCGTCCTGGGTTATATCTATGTAGTACCGTACCGAGCCCTGAGGGTTAAATACATATGAATAGGGTT
AAACGCACCTAATAAATAAACCAGAACGCTTACCATGGCCGGCGATTCCGCCCGGGTTGAGCAGACTCGAGTGGACCCTCGCGCGGTTGAGGATCTCCTC
AAACTCGTTGAGTGTGGGCGCCGCCATGTGTGCAAAGTCCATGACGACGTTGAGCGAGCCGTACATGACGCAGTAGAACGCGTCGGCCGCATCGCCAATG
TTGAAAAGCGCCTCACCCACGTCAATCTCGATGCCCTTGACGGCCTTGAGGTACCGCAGGCGCTCGGTCGGGGGCACGTCCGAGAAGTAGGTCACCGAGT
GCACTGGCAGAGTAGAGTGTGTTAGTTATGGTACATGCGGATATATAGGAAGGATAGTACCGTATTTATCGAGGAACTCATAGTCGGCGCGGCCCCGAGC
GGCGTCGGACGTGAGCAGGATGCGCTTGAGCGATGCGCGCACCTCGACCGTCGGGTTGTCCCCATCAA