Description :
From Genome Similarity Track
Location :
scaffold_1053:12- 1284
Transcript NameFunction/comments
g10904.t1 hypothetical protein PHYSODRAFT_398253

Sequence
1272 bases(100 bases per row)
GGGGCGCAAGACGTCGATATGGAGTCAGTCTGGACCCCAGATCAGCACTCGTGGGAATATGACCCGGATGATCTTGGGATCTCGAGTCCCGCGGGAGCAA
CAGTGAGCCAGGCGGCTGTGGCTACGGCCGCGATCGGGCAAGGAGGATCGTCGATGATCCAGAGAGTCCGGATCTCGGCGATCTCGGATCTAAAGGAGTT
CACCGGCAAGGATCTCGACGAAGATCGCGCCCGAGCCTGGATCAGCAAACTCAAGTCCGCGTTCCAGCGAGATCAAGCCACCGAGGAGGAGAAATGCCTC
ACCTTCGCGAATCTCATGATCGGCCCGGCGAAGAACTGATATCGACAGCTGAGTCGAACGACCAAGACCAAGTGGGCAGATCTACTAGACAGTTTCCAGA
CACAATATTGTGGTCTAGGAATGTCAGTGGCGTGGCAATACTACCATGCACGCAAGCGATCTGAAGAAACCCCGCTCGATTATCTCTATCGTCTGAATGT
GGCCGCCCTGCGAGCCAAACTCAAGATCAAGGATGGAAATCCCAAGGCCCGCCGGGAACACGTCGATCACTTCATCGAAACTTTGGATGATCCCGAGCTG
GCCGATCGTCTGACTCTGCTTCGACTAACTGACGTCGACGATCTGGAGGAAATTCTCCGCGCTCGAGAACGGGCGAAGAGCAGACAGCGACGATCTGCGT
TTGGGTCGAAGTATTGACAGAAGACTCCATCGAGCACGCCCACGGCACCCGCAAGGGCCGTAGTGTGCACGATCCAGGCACAAGACCCGAGTTCGGAGTC
TGAAGGGGTGTCCGGATCAGAGGGATCTGACTCTGAAGGAGATCTACGAAGGATCTACCTGGCCGCGGCTGATGATCAGTCGATCGGTGCTGGGGGCGGG
TCCCACCCGCCAGATCAGGCGCGATCTCGCTCGAACACGCAAGATCGAGGCCGGATCTCCGATCACCGAACCCATTCCGATCGTGATCACCAAGATCGAG
GTCGATGCTCGCGTTGTGGATCCGGGAAACACACGGATCTCGATTGTTGGAGGCGATTGACCTGCGAGAAGTGCGGGAAGAGGGGTCACCCAACGGATCG
CTGCCTATATGTGTGCCGTGGGTGTGGAAAGGTCCACGAAGCCGGAGAATGCATCATGGAAGAGTTCTACAATCAGATCCGCAAGTGGTATGATCTGACT
CGACACGCAGGAATGCTTCCCGAGAAGGTGGAGAAGATGTTAAACGAGGACGCTCGCCGGGTTGGAATCCGG