Description :
From Genome Similarity Track
Location :
Scaffold_4503:12- 1092
Sequence
1080 bases(100 bases per row)
TAGATACTCGCGCTCCTGCACGTGTTAGATCTGATTTACAACCTGCTGATGGGAAGATCCATCCGGATCCCTGACCCGGACACTTTACGCTAGCCTGGCT
GTTCAAGTCGGCCGGGTTACAAGGACGTTTGAGACAGTGAGCAGCTTTACTCTCGCCTTGGACACTAGAGATTGTGAAATGTTCGAAAGGGGAAGGCGAG
ATCCTGGGCGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAGATGGATGAGGCGCTGACTAGGATCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGA
TCCCGATCCCGACGGTACAGGCAGACGAGGATCTGTACGTCCTAAGTTTCGATGGATCCGCTCGCATACGACGCGGAGGCGGGGCGTACAGTGCGATACT
GTGGAGACTACCTGGATGGGAAGTAGTACGGGCCAGATCCACTTATGCGGAAGGCCTCACCGTCAACGAAGCGGAGTATAACGGGCTACTGCTGGGTTTG
GATCTACTAAAGGGACAAGATCCAAAAAGGCTGGTGATTTGTGGGGATTCAAATTTGGTGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCTG
CCCTAACACTGTTACGGCAGAAAGTGATGGTCCACCTGCGTGGTTGGATGAATCACGAGTTGGTACATGTCAAGCGAGATTGGAATGCCAGTGCAGATAG
CTTGGCCAGCACCGCTTTACGGAATCAATGTGGTGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGTTGAACCGACTAGACGAAGTGGTA
GTAGTGGGATCCGGGAAAAGGACAGTTTAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAACCCCCAAATTCTCGAGGAAACATTTGTGA
AGAGAGTCCGCATCGAGCGGATCCTCAAAGCACAGAACAAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGAATGTACGAGACCTGAGTCG
GGAAGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCGGTGGATCTGAATGACTTGCTCTTCTATTCCCCCCCTA