Description :
From Genome Similarity Track
Location :
Scaffold_3691:12- 1056
Sequence
1044 bases(100 bases per row)
CCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCTGTTGGTCTCGGAGTGGATCCAGCTCCTGTGTTAGGTCC
TCTTCTGACGTCATACCACTTGGATCCCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTTGTTGGATTTTCATCCGGACAGCTGGAGCGGTCATCGCAG
CAAAATCTACCTCTCTTAATTCATACAACACTGCGGCAAACAAGGCGTAATCTTTGTGGTGAAGTGCTTTCTCAGAAATAAGAGAATGGTCCTGACGCGG
GGTCACTATCCCGAATCAGTGACAATTTCAAGTGATTATAGAGGATTTGGGTTGTTTGGCACGGGTGCAAGTTGCCTGTGGTGGATTAGCCATGGCGAGC
AGCACCCCGTATGGAATGACGATGGATCTGATATGAGCGATGTACGAGAAGGCAAGATCCACCAAGACTTACCTCGGATCCACCCTTACCTGGATTCACT
AAGATGGATATGGGATATACTATACAAGAGTGGATCGAGTGCGGATCCTATGAAGGAAGGATGGTCGGTGCCCTCTGACGGTGGATCTAGTAGCCACGGC
TAATGAAGAGTCAAGATCCACCGCGAGGTACCCCGGATCCCATACTTCTGAGTTCGTATCCAAGGAGGGAGGATCCCGCCTGGAGGGACCTGGATCCAGG
GTATAGGGATGAGGGATACAGTGGATCTCGAACTTTCGTGGGACAATGGAGATCACAGACGGTTGCGAGATGATGTTGGATGATTGGAGAGCTCGGATCC
ACGGCGAGTGTACCATTACAGTGAGGTGGATCCAAGCGACCTGGATCCGGATGAGTGTACCCATAATAGGGTGACCATGATGATTACGTCATATATCCGG
TGGATCTGAAGATAACACAGCTGGGATGATGGGTCAAGGGAAGAAAGGACATGCAGCCGAGCCTGGTAAGGGATTTAGCAGATGAAAGACATAGAAGGTA
GAAACCCAGGCAGGTATAGGCTTAAATATCAATACAGACTCCAA