Description :
From Genome Similarity Track
Location :
Scaffold_15:11995- 19809
Transcript NameFunction/comments
Hyaar_Emoy2802746Eukaryotic/viral aspartic protease
Hyaar_Emoy2802747hypothetical protein

Sequence
7814 bases(100 bases per row)
TCGTGACTCTGCATAGCTTCGAACCGATTATGGCTCATCTGCTTGCGTTCAAACGCTTGAAGTAATGCTCCACAATTCAAATCAAGTTCATACACCCAGG
TGGGGTCGTCGTACCCCTTCCAACGAGCAAAAATTCTCGTTGCTGTCGCCCATAACGTGTTTTCTTACCATTGCGGCTGTCCATAATCTCCTCCACCTCG
TATTCACCCTCTTCCAATTCTCGTACCCAAATATCTTCCGGCAGTAGGCATTCGTCAAAATCAACCCACTCTGCTTGTTTCACTGTTAGCTCGTTGTCTG
GTCGATCAGGGAATTTCCTTACCCGCTTGAGCTTGGATATGTGTACAATCAGGAACAACCGGTATTCCGTCCCCCAGGTTTCCAGACGTGCGGCATGGTC
TCCCACCAACTCCAGAACGCGGAAAGGTCCGTGCCAAAGATGAGCCAGTTTCCTGGCATATCCTTCTTTTACTCGGTCAAGATAGAGCCATACTTGGGTT
CCCGGTAGAATATTGTGGACAACCACCCCTTCGTTCTTCAATTGCACTCGCATCTGACTCCCTTCTAGCAACTTCTCATTCACCTCTTCTCTTGCTCGCT
GGTACTGGCTTTGAATGCGGTACCTCCATCTTCTGGGTTCTGAATCCTGACGTCGGACGTTCACTATCGGTAGTGTGGCTTCAAGGGTGGATTGGACATC
CCAACCGTGGACCAAACAAAGGGGGGCTTTTCGTACCCGGTCCTGTGCGGTATTGATCGCAAACGTCAACCGCTCTGCGTACTCGTCCCATTACCGTTGC
CCTAACTCCGCAACGTACAACTTGATAGATGTGGTGAGAGTCTGGACCATCCTTTCCGCCGTACATTAGCTTGGGGTCGGTAGGCAGTTGTCGCTTGTTG
ACGTTGACCCACCATATGGTTAAACGTTTGAAAGAAGTCCGACATGAATCCCGGTTCTCGATCGCGACGGATCGCCTCGCTAGCCCCAAAACGATGGAAA
ACACATTCTTCATATCCTTCAGCCACCGTCTGAGCTGTCTGCGACGCGCTAGCATTGGCTATTACATATCCGATGAATAAGTCAACACATATCAGAAGTT
CCGGATTTCCTTTATACGACTTAAGTAGGGACGGAATATGGTCCATCGCTTAAACTTGGAAAGGATAAGTCGATTCGATGTTCTCAGGGCTCTTCCCTTG
CAGGTTAGGACCCCCTTTTCCAGTCTCACTAACCATGCAAGAACCAACGTATCTCTGCACACTCCGAAACAAAAAAAAATCAGTGACAGTAACGTCGTAT
GCGTTGGTATGTACGCCCGATTCCTTGATGACCTCCGTCAAAACACGTATGGTAGTGGTGGCAGAAGTCGGTCTGGAAGCTTTCCGGTATCACCAGTCTG
ACCGTTACGTTACTGTATTCTCCCTCTAATCTAGAGTTTAGACAATATACCAGCAATCCTTCCTCGCTTACATCGTAATATCCGTACATTTTGCCGCACT
TCTTAGCCGATTCCACTGACAGGTCATTCCAGTCTCTTTTCAGATATGCTTTCAAATCTCGTCCCCAGCTCTCCTCTTCTTGCGCCTTTAGAATTCAGTC
CACGCGAAGTCGCTGTACTACATCATCTTACATGATCTCTCCGGATATCCTAATAGGAGACCGCGACCGAATTACCGCAAATATTTTGGTCGAGAGGTTC
TAGTCTTTCTTCGCCCGGTACCGACTTTGTTCCCCCTTTTTGGTGCAAGGAGGTAATAGCCAACTGATCTGCGCTCTGGTTCCAATCTTGTTTCACATGC
AGGATTCCGTGCGAAGGCTACGATTTGAGTTCGTTTAAATCTCGGGCTCGTAGCGGTGATAGACCCGAGGCCTTACACTCAATCTCACCTCTCATCTGCC
GCACTACTAAGTTGGAATCTCCACAGATAATTAATCGTCGCCGCTCAAAAGGTTTAAACAGGATAAATCCAACACTATATACCCTCATATTCTGCCTCAT
TTACCTTAGAAGTATCGAGATATTGGAGGCGGCTTCGACTTTGGTCCAATTCGAGAGTCTCCACGCGATAGCTCTACAAGCCCCACCTCTTTGCTTGACA
CGGGCTTACCCATCGAAACTCGTTTCTTATAGTTCTTCGTCTGGTTCCACGGTACGGGTGGGTAGGTCTACCGTCTGCCTCGCCTGCTTCTTAGGGGTAA
TGGCCGACAGTATTGAGTCTACATTATCTCGAGGGGTGACACTGGCTGCCAACGCCCCCAGCACGTGGTCTTCACCTTCTTTACACTTCACAATCTCCAA
ACTCCACTGAGACAAGAGAGCGCCCCCGTTTCCCAAGCGTCCCTGCAATTCGTCAGACTTTACCAACCATGCTAATGTCGAGTGTCTTGTCAAGACTTTG
AGGGGCCGAGTGACTGGCATAGTGAAACAGGTCTCCAGTATACGCAATAGGGCCAAAACCTCTTTCTCCACTGTACTTTAATTTAGTTCGTTAGCCTTGG
GGGTTCTGCTTGTAAAGGTTACCGACATGATCAGTCCTTCATTGTCCTGTACCAGTGACGCTGAAATAGCCCATTCACTCGCATAGACAATAATCACGAC
TCCTCTGGTCGGGTCGAAGTGTATCAGAACTGGCGCCGTGTCAATTTTATTTTTGAGCACGGTAAAGGCTACTTGAACGCAGGCCCACCTTTCTTCATTG
TCATCCTGGAAAGCGGCATTATTATCTCCCTTCAACTGGTTTAGTCGGGCATGAAAGTCCACTTCTCTCAATTCATAGAGAATAGATGCATACACGGCGT
AGTCCTCAACAAGCCTGCTATAGTAATTCAAGATTCCCAGAAAAGATTGCATGACCTTCAGTGTTATTGGTAGGAATAGGTCGACCAGTGATTAGAGGTC
TTTCGGGTGAGCCTCTATTCCTCCACTGGATACTCGCTGTCCAAGGTAGTCGACCTTCCGCCATCCCCACGAACTCTTGACTGCGCTGATTGATAAATTA
CAGTAGTCGCGCACATCCAACAACCGTTCCAACCGTTCCACCTTTGTGCATAACGCACCCCACGATTCTGCGGGGATCAGAATGTCATCTATGTAGGACC
ACCGACCCAGGATCGAGGGAATCGACTGCTTTTCTGGCTCTCCTACCTTGAACAAATCATCGGACCCATCTGTCTCCGCTTCTGGAGGGATTAGTAAAAA
CTCGTATAAAGCGTTATACTGGAGTCGTTGATATATTTGGGGCGCGTTCTTGAGCCCAAACAGCATTCGCATCCATTCAAACAAACCCAGTGGGGTAAAG
AACGCCAATATTCGTCTCGCCCTTTCAGTCATACCGACAAACCAAAAACCACTCGCCATATCCAATGAGCAATACCATAATGCCTTGTTCAAATCTTCCA
GTAAGCCATTAATCAAAGGCATGGGGTAAACCATTATTTGAGTCAGGTCGTTCACCAACCTGTAGTCGATGCATAGCCTGATATCCACCCCATTTTTCTT
CACAATAATAATGATTAGGCTGGCCCAAGGTGACGTCGAAGGCTGTATAATCTTTGCCGGTAACAGCACCTTGATCAGATCGGCCAACTTCTCCTTAAAT
TGGGGAGCCGCTTTGCGACGCGTTGCGCTATCAGATTTGCATTTCCTACATCAATGTCACATATAGCCCCTCGAGTTGCTGGCGGTAATACATTCCCTTT
CTCCATCAACAGATGTCGTCTCTTCCAAATGATTTGTCGTAGCCGGTCCACCCCTTTTGGGGTGTTCCCATCCGGATCAGAAATGTGTATATCTTTCAAC
TCAATAGATTCGGAGGAGGGGTCCACTTCTGGTATGATTGCCCACCCTAGGATTATTGCTTCGACCCACAGGTCTCCGCTTTCGAATGTATACACTTTTT
GCCGTCTCGTGGCGATATGTTGGCCTCGGCTTCCTCTTCTTCGACTGCGATTGCTCCCGGTGGGTCTCCTTTGGGACCACTTCGTTCATGAAGGTTTTAT
TCTAGTAGAGGCACCTCTTCTTCGCGTGACAGTTCTTTCCTCTCGGGTAGCGGCTGGTGTGACACTTGAATCATTGAGACTAGGGTCTTCGAACGTAAAA
TGCAAAATATACGACGGGATCTTATACTGCGGGGTCTCCACTAGTGGCCCCTCGTCTCCCTACTCGAAGTCAACTGAGGGGTAGATCTGGTCGGTGGTGG
CTTCATATACCAGATTCAGATGCTCAGCGTATCTTCGAGAGCCCGCCGAACGTAATCTTGTGCTCTTGGTACTTGATGCTTTGTCAGCCACATGACTATT
GTGGTATCATCATGTAATGTTAACGTGTGGGAGCTGACGTTTGTCACCTTCAGCAATTGTCGGCGTCCTATTCCCCGGGTCATACTTGGTACGTATCGCT
CTCATCTTGTGACCCATATCTTTCATTGTTCTGAGGTCGACCTGTTTTCAGAGGTATCTCCACACATCCACCAGCAAGTATATGGGCATATTGTCCCAAC
TTCACGTCTGAGACTCGGTTATCGTAGACAGTCCTCCGTCCGGAGAGTAGTATCCGGAATTCGTCAGGGAGACAGAGTGTTCCATCCGCCAGGTCTAGCC
GAAAACCAGCCGGGACCATGAAGTCCACTCCTAAGATGGCATCATGAACCACCATAGACCCTATCAACACCTTGAAAACGTACACTAAATTATCATTTAG
GGTAGCCTTGATGAGAGTGCGCCCTTCGGTAGAATACACCGATTCCCCAATGCCAATGCACTTTTGTAGTTCGCTTTCGTCAATTTGACAACCTACCTTA
CGAGCAAAGGCGACATCACAAATGGGTATCTCGGCACCAGTATCGAACAACAAGTTTGCACGATCGTTGTTCATCTTCCCAGAGGCTTTAGATTCTCCAG
GAAATAGGTCGAGCTCCATCACTGCATTTTCTCGAGCGAAATCATTAGGTTCATTGAGAGAGACAACATAAACCATGAGATGTTTTCCCATCTTCGATAT
AGTATCGGTCTTCTCAGTGGAAAACCCCCTCTCCTCCTTGGGCTGCTTTTCCACATATGCAGAAATACAAAACCTAGAACGATCGAATCGTACCAGATTC
AAACCTGGCGAGCGTTCTAATTTATCATCTTCTCAGCTTTCTCCGACAACATTCCGGCGTGCTTGGTGGAGCAGTACCATTGACGAATCAGATTGTAGAA
GTCCTCTATCTGGCACTTTCCCGCTTCGTGGGTCTCTCCCCATCCCCAACACACGAAAAAATAGCGATCTGATGAGTGCCTCTTCTTCACGCAGTGGTCA
CAAGTCATTCTCTTCCAGCATCTCAAGTCTCCATTTTTCCTGGACCCGCAGTGTGTACATCTTACGTTTGACTCGGCCGCCGTATTACGGATTCCAGGGT
CTTCTGTTTGTTTCTGATGCTGGTCGACTTCTTCGGTTATACGGTCTATCATGGTCCTTTCATTATTTTGGACTATTTCTGCTTCCGCTAGATAGACCCG
CCTCATGTCTTCCACGTTATCTAAATTTTCTAGGCTGGATCCCTCCGAACCCGATCTTTCTGTGGGCTCTCGAACCGCATGCACAGAACGGCAGCTTACA
TCTCTAGGTCGATCGAGAGGAGCTGGCACCTTTTGCCCGAACTTTCTGGAACCAAACAGCGTCTTGCCACGCCGTGCCTTCGTCTTCTGGCACGCCTTCA
ATACTTTCCTTAATTTTTCCACATCTGCCAGACGTAGCATCATCGATTGGTCTGTCCACTCTGGGTCGTCCACGGTCTCGATGTAATGCTCGACATGTTC
CTTCTGGATCTTGGGTGACCCAATGTTGATCTTAAACATCGCCCTAAGAGCGATCACGTTCAGGCGGTACAGGTAGTCCAACGGGGATTTGTCTGACCTT
TTCTTCGCGTGGTAGTACTGGCGGGCGACTGGTACCCCCAGACCACAAAACTGCATCTGAAATTTTTGTAGCAGGTCCTTCCAATTTCCTCGAACGGAGC
GGCCCAATTGGCGATACCAGTTCTGCGCCGGCCCGATCAGCAGTCCTCCGAAGACCAGACACTTTTTGCTGTCCGGTGCTTGGTCTTTTGCGAAGGCCGT
CTTCATTGTGGTTACCCAACTGCGAGCTCGGTTCTCTTCCAAGTATCGACCACTAAACTCTTTGAGGTCCAAAGCTGCCGAGAGCCTGATGCGAGGGACC
ATTTTAAGTCCCTGTCCCATCGTGGAAACGGCCATCCTCGCTGGAGTTTCCTCCAGGTCCAGATCATCCGGTTCATATTCGCACGGGCCGACCGATTCCA
TGTCGACGTCCGACAGTGTGGGTTGTCTTTGACCTGAAACCTCTTCCCTCGAACCATTTCCAGTACTCGCTGGTCGTGCTTCCTGTCTCTATCCGGTCTC
TTCTCGGTTAGGGCGTTTTGATGGTGCTTGGCGTTCTTGTAGGAACCTTGCCATCGCCGCGTCGAATTATGCCTGCAGACTACCTACAGGGTGGGTAGGC
GCTTCCCCCCCAGCATCTTCGCCACGTGGCGGTGCTAAGGTTTCGGGGTGTTTTGGTCGATCCGATTATTGGGCGAAATTGTGGCCTATCAGGAGTCCGC
ATTTCCGTTAGCTGTCCACGAGTCGCTCCGTCGTAAGTAGGCTATTCCGCCGGCGCATCTCGCGCGCAGGCCTGAAGTAACGCGGCGCCGGTAGGTCCCA
GCGACATTCGAGTGACGTGGCTGGGCGTTGAGGATCCTTGTGACGAGTATCCTGCTGATGCTTAGCCACGTGAAGACTGGGTATCGCGGGATGGTGGGTC
AGTCGATCGTGGGTCCTAGGTCACTGCTTGTGTTGGGGGGGGTGAACCTCGATATACCGGAGAGTCATCTGACTTTTCTCTTAGGGTCGTACACGTCTGC
GGCTGGAGACAAGGTGTGTCCCGTGGGGTGTATCTCGACAAGAATTGACACACGCTTGTGTAGTTTTCATAACGTTGTTGTGATGCTGTCGAACCTCAAG
GCGAACACGCCGTTCGGTTCGAACCTCTCTGCGACCATGCCTACTTCCCGAAGGAGGATCACTAGCGCGGTAATTGCTTCTTTGACCTTCCGTATCTGTG
GAAGGGGCGACAGTGGTCCGCAGAGCTGTCCAAGCAGCCGGATCTAGAGGGATGTCGTCTTCGGGTCGCTGGTCAGGAACGTGTCGAGCTTACATCAGTG
GTAGGCCATCGTTATGTCGGTGTCCGACCAGGTTAGTGGCCCTGAGAGTTCGGGATCGGCAGACTTGGTGCCTGGACTTGAAGGTCTGGGACCAACCGAC
TTGGTATCGCCGGGTGCCTTCATCTGGAGCTTTTTTGGCTTGAACGTTGCGTTCTTTTGTTGTTTCGAAGACTTTGGCATCTCGACTTTCACCGTCTGCT
TTTGGTCTACTGGGGAATGATAGGTATCATGGCTCAAGGTGTCCCCTGCGAGGACAAAGGGGTGGTATTTAGATTTCCCTTCGAGAACTTCAACCTTGAC
CTTATTGACCTGGCTCCTCCCAAGAACCGGTCGGTCCTTGGATCCTTTGTCTTTTTCTTCTTTAGTCACAGTCGATCGGTCCTCCAGTGACGCTTCGGTG
TTTTTCTCAATCTTAACTTGAGCATCTTCGTCCCCTTGGAACTCGCGGTGAAATTCCGCATCTTCCGAAGATACGGGCACACGCACCATTGTGGTGGAGT
GGGTTCTCAAAACTGCGTGTTGAGCCCCCAAAGACTCACTGTGCCGGACTGCCAACTTACGGGGGGGTATCCCGATTCCGGGTATGAACCTTGACTCACC
TTGTGTACCCGTCG