Description :
From Genome Similarity Track
Location :
Scaffold_156:11992- 13681
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_156-snap-gene-0.23Ubiquitin family protein

Sequence
1689 bases(100 bases per row)
GCAAATGGATTGGATGCGCCAGAACTTGGAGCTGCTACTCCAAATGGCGAACTACCAAGTCCACCTCCAAAGTCGCCACCGAAGCCACCGCCAAAGCCTG
CTCCACCTGCTCCGCCGAGCATCTGTTGCATGCGTGCCATCGCATTTGGATCCTGCATCATTTGGTTGATTTGCTGCATCATCGCAGGATTTTGCTGCAG
CATTTGCAACTGTTGTGACAGCATGGACGGGTTCTGAAGCGCCTGCGCAATCATCGGGTTCATTTGCGCCATTTGCTGCATCATTGGGTCGTTTTGCAGC
ATCTGCGCCATCATCGGGTTCTGCAGCATGCTCTGGGCTTGCGCAGCCCAGTTGGCGTTCCCTGCTGCCACGCCGGCGCCAAATCCAGGAGCGCCAAACG
AAGGCGCGGCATTGAATCCGGCTGATCCAGATGATGCGAGAGCCTGATCGATCACGCGCTTCCCCGTAACCAAGCAATCCCATTTCTCCGCCGTTGGCAC
GAGCACAAGGTGACCCTATACAACGAGATATACAGATGCACAATGCATTAGCCTCCAAAGCATATATACTTTCAAACATGCCTGTAGACATACCTGCTCG
ACGCCTTCTTGGAACCCCAAGAGTTTCACACAGTCGGTGCCTCGAATGCGATCGAGTAAGCGCGTTTTCAGCGCCGCATTCGCCACACGCAGCTTGCGGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCCTCGTGCGGGTGGTTGATGACGTTTTCGCAAATCTTCTGCATCGTCTGGATCGCCGTCACGTATC
CGGAATCCGCGCGCATTTGCTGTAAGAACGCACGCAATTGTGGCTCAATGGAAATCGCCGCCGGAGCTGCAGCCACAGTCGTCGGTGCATGCGTAGCCGC
GCGCGCAGCGCCCGGCGTGAGCGTCAAGTGAATCGCGCATCCGTCCTCGACGTTGTACTCGCTCAGCTTCTTCTCGTTCTGCAGGATCTGTCCCTGGAAG
ATGAGGCGCTGGGCCGCGATGGGGAACCGCGCCGCGTCCTTCGCCTCGATCAGCTGCTTGAGCGCGAGCACCGTCGCGTCCGCGAAGTTCTCCATGGANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGATCGTCAGTTGCGCTGTCGTCATGATGCGCACGCACAGAGAGGGGGGAAATGC
AGGAATTGGAGTGCGCTTCGCTCCTGCTTTGAGTTTCTTTTGGGCTTTTCTAGATCATCGACGACACGACCAGAGGGCTTCTATTAGATGCACAGTCTTC
TAATAAAAGTAATTTGGTAATAGTACCGTAGTATATGTTTTGTGCATGTACTGCAAGCGTCTTGAATAGAAGACCTATATTGTTGCACTGTGTGAGCTTG
AAAGGACACGCACATTAGAACTGAAGACCGTGATGGAGAAACATGGCTCCAGTGGCAAGAACGTGCACCGCAGCGCAGCTCATGCCGTGCGGAGGGAATC
TGCAAAGGTGTGTGAAGATGGGCGTGAAGATGGGCGTGAAGGTGGCGCAGACGACCAAGCAGCGCACGGACGCGAAGAAGCCATTGGCGAACTGAGTGTC
ACGAAACTCCCAGCACTGGTTCGCGAAGGTACGCTTCGCTGCTCTCTTAGTGACTGTCTTTGCAGTAAACTACTGCGTATGGGATACCA