Description :
From Genome Similarity Track
Location :
Scaffold_298:11990- 16304
Sequence
4314 bases(100 bases per row)
TGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGCCCCATCGGGCGTAC
GCGCAAACGTACTTCGATGACATTGTTGTCCACAGTCGCGCGGAGCACGGAAAGACTGATATGGAGAACCATGTTGAGCACCTGCGTGCTGTGCTCGAAT
GCGTGCGTCAAAACAAGTTGTACGCCAACATTGACAAATGCATCTTCGGAGCGGAAGAGATCCCCTTCTTAGGGTGCTTCATCGGGAAGCGTGGCCTGAG
GGCCGACCCGGTCAAGGTCAAGGCCATTGTCGACTGGCCGGTTTCCAAGAACCAAAAGGATCTTCGCAAGTGGCTTGGCTTGGCCAATTACTTGCACAAG
TACAGCGAGAGCTACGCTGAGATGGCTCGGCCACTCTCCAATCTCCTGAAGAAGGATGCGGAGTGGTGTTGGAGCACCGAGCATCAAGATGCGTTCGCGG
CCATTAAGGACAGTCTCCTTCATGCGCCTATTCTGGTTCTGTCAGACCCGCTCGTCCGTTTAGTGTCGTCTGTGACACTTCGGACTTTGCCATCGGCTGT
GCACTGCTGCAAGCAGACGCCGAGGGGCGCGAGCGCGTGGTGGCGTTCGAATCTCGCCAGCTGAAGGCTGCGGAGAAGAACTATCCTGTCCGCGACAAAG
AGCTACTTGCGATGAAGTATGCGCTCGTCAAGTTCAGGGTGCACCTGTTGGGCTCTCAGCCGTTCGTGATTTACACGGATCATGCGTCGTTACGCACTGC
GACTCAGTCGCCTCACCTCTCGCAAAGGATGGCCCGTTGACTGTCCTTCTTCGCGGAGTACAACTTCGAGGTGAAGTACAAGCCTGGCAGGCAGAATGTC
CTTGCGGACGCGCTGTCGCGCAGGCCGGATTACGAGCTGGCTCATGTAACGACTGTGACTTCGTCATTACCGGATTTGATCCGAACGGTTTATGGCAAGG
ACGACACCTGTGTCGCGTTGCTGAAGGCTCTGGGGAGCAAGGCGTTTCAAGACTCGGACATGGAATTGTCAGCGCGGCTGCGCGCGCGGCTACACCGCTA
TTCCCTCGATGGTGGCCTGTTGTTCTACAACACTGACCCCGAGGATACGCCCCGCGTGGTCGTCCCTCATGATGAGGATCTGAAGTACCGCATCCTCTAT
GAGGCGCATGACACGCCGCTGGCCGGCCATCTTGGCCGTGAGAAGACCTACAGCTCGGTGAGCACCCACTACTGGTGGCCGAAGCTGTACAAGTGGACGA
GCACTTATGTGCGCACGTGCGAGACGTGTCAGCGCGTGAAGTCGTCACCTCATGCTGCAGCGCCGTTGGCGAGTTTGCCTGTCCCTTCGGGCTGTTGGCA
ATCCATGAGTATGGACTTTGTGTTTGGCCTGCCGGCGGATGCGGCGGGCAACACAGGAGTCGTGGTCTTCGTGGACCGACTGAGCAAGATGGCTTACATT
GCGGCTGTGCCGGA