Description :
From Genome Similarity Track
Location :
Scaffold_3:1198904- 1201391
Transcript NameFunction/comments
Phyin_T30-4PITG_02248MBO2%2C coiled coil flagellar protein
Phyin_T30-4PITG_02249Putative uncharacterized protein
Phyin_T30-4PITG_02250Putative uncharacterized protein

Sequence
2487 bases(100 bases per row)
GCCGAACTTGAAGCGGAAGTTGCCCAATGGTTAGTCGAGGAAAGTAAACAGAAAAAACTGGTGACAATGCTCACTGCACAACGCGAACTGAAGGCTCGTG
AAGCCACTTCGGCGTTAAACTCGGAGCGGCAAACGCAACAGGAGCTTAAAACCAAGGAGCTCGTGATTTTTGACTTAGCAAAGAAGTGGAACGAGACGAC
AAACCACTTGCGTGAATTCTCGGCATTATACGACGTCGTCAAGAACGAACGCAACAAATATGTGAATCTCATTCAGGCTTCGACGCAAGCACTAGCTGAA
ATGAAAGAGAAGATCAAGATTCTTAACAACGAAGTAGAAGTGCTTCGAAACGAATCACTAGCGAAGGATAAGGCGCTTGTGAAGGAAAAACTAGCGCATT
CAACAGCGCAATGCTCGCGTGACTCGCTGCGTCTCGACACTAACAAGTCGCACGATGCATATCGAACGAAACAGGAACAAGTTGAGCAACAAATTGTTGA
AATTGACAAGCTCAATGGGATCATAACGCACACGGAGAAGGAATTGCTACGTCTAAAGAAAAAGTACGAGCTCGCAGTGGATGCACGCAACGGCACTGGT
GTGCAGCTCATTGATCGCAATGACGAGTTGTGCATTCTCTATGAAAAATCCAATCTGCAAGAACAAGCTTTAAATTCTGGTGAGACGGGCTTGTCACGCA
AAGATCAAGAGATCCGAGTGCTTAAAATCGAGCTCGCTGACCTCCAGCGTCAGCTTGAAAATGCTCGACGACAGCTACCACATCTACCTGAGCTTGCGCA
ACGTATCTTATTGTTGCAAGAAGATCTCAAGCAAGAGAAAGACGTGACGGAATTGCTCTGTCGCGATCTGGAAACCCCAAAGAACAGCGATCGATGGCGT
TCTCTTGGTGGTGAGGACCCCGATGAAGATCAGCTCACCGCTAAATTAGCGTATCTGGAGGATCGATACCACCATAAGAAGGAGAAATTGCTAGAGAAAG
AACTGGTGTTAGAAGAAGTCACTGGTCTCTCCAATAAGCTTCGAACGCAGGCCTCTGCACGTCGTGGCGAGACTTTAGAACTGGCTAAACGAGTGAACGA
TTTCCAAGGTCGAATCAAGGAGACTACACGTCGCATGATGGCTGTTGTCTCGGAGCTATCAATGTATCAAGCTACAGCAATGAAACTCCAACAAGAGAAA
CATGACGCTTTTGTTGATGTTGAGGACTGCCAAAAGCGCGCACTTGCAGGCTACGCACCAAACGCATATAGCGAGCAGCAACTAGTGCGATTACAAGCTC
AAAAGCTACACAACAACGAAACTCGGGCTGCAAAAGAGATGGCAAAAGCTGCAGCTGCACATGCTGCCAACTTCCCGTCTCAGTTCACGTATACAACCGC
AGAAGCTCGACCGAATGCTTATATTCCAGATGACCTGGGAATCCCAAAGCCATACGGGCAACAGGCACCTTTCAAGCCTACGGAACAAGGAACAACGATG
CGTCATATCCGTGTGCCGCAAAAACGGGATATCGAGATCTAGAGAGCATATTATCGGTTCATTATTGCACGATCATGTTCCAAGTGAACAAGAATTATCC
GCTTCCATCAGTAGCGTGCTTCGTGAGCTTCTCATGAGCTTTACGTAGTCTGCTGTCCAGACTGAGCATCTCTGCTACTGACTCCATGAGCTCACGTTTC
GTTTTATCCAGTTTTTGTTGTATGTTGTTTGTCAAAGGCTGCAAGCAACTCCACCTCCTTCGCTGCTGCAGTCTGTGCGGTGGCTCGAACTTCTCCTTGT
AGCTGTACAATCGATGCCTTTGCACTCGAGAGCGTCTCATTTGAAGCTTCAAGACGCTGGAATGCCTCCTCAAGTTGTTTCTTGTTGGTTGCTAACTCTG
CTTCAGCTTGATGTGCTCGAAATTCCCAGATATTACGCTGTTCACACGCTTCTTTAGCCTGCTTCTCATGACGGTTTGCAAATTGAATCATCTCATAGCG
CGCTGCCATCGCTAACGTGACAAGTCGTTCCTTCCGCTCGTTTTCCTGCAGTGCTTTATTACGTCAAACCGAACATGTAGAAGCAGAAAGGAGAACGACT
AACCTTGGTGAGAGCAGCAATCTTCTTGATCTCTTCTGCTAGCAAGAGCGCTATCCGGTCACGTTCCTGTAATTCACAAAGTCATCAAAAGTATTTCGAG
AAGCCACCCCATTTGGCAGAGCTTTTACCCGTTTGAGCTCGTCTTCATCTTCTTGTTGTAAAGTCAACGTGCTGCTTATGTGCTACAAACAGCAATTGTC
ACGATATTAATCAATGTATCTGCTGCACAGATCATGGGACGAACCTTGTACATGTTGGTCGTGAGCTCTACACTGAGTTTCACTTCTTCAAACGCCTTGA
TGATGTTAAGCATCTGATCTTCCATCTACGTAAAAAAAAAAGTTAGCACCAGGGTCTTCAGCCGGAAGGTACAAACTCCACCTTCTG