Description :
From Genome Similarity Track
Location :
Scaffold_123:119867- 122001
Transcript NameFunction/comments
Physo_142871hypothetical protein
Physo_142872hypothetical protein

Sequence
2134 bases(100 bases per row)
ACATCAGCAACCTTCCAGACTGGTACATCACCGAAGATGAGGTGGACATTGACATGTCGACCGTCGTTGGCTATGGCGGTGACGCCAAAATCTACAGAGG
AGTACTCAAAGACGGCACAAACGTGGCAGTCAAAGTCTTCGATGCCAATGTGAAGAGGTCCGAGGAAGCAAAGCAAAAGTTCCTCGAGACAATGAAACTG
TGGGTGCGTTTGAGCCATTTTAACATTTGTCGTCTCTATGGCGCCTGCTACTTCACGGCAACCCCCTTCGTCGTGATGGAGTACTGCGAGCTGGGGTCTC
TTGACACGTTTCTCCGGCAAGACAGCCTCAATCGCGCCAAGGTTAGTCTCGACATCCTTGCTCAAGCCAGCCAAGCGATCAACAAGATGCATTCGAAGGG
GATCGTCCATGGCGACTTGAAGTGTGACAACATCCTGGTCTCGGCGGGGGCTACCCCGCAAGCGAAAGTTTGTGATTTCGACCGCAGCTTTGACTGGAGT
GCACTGAAAGACAAACGGCTCGTCAATGGGACAGCAGCAGCTGCGGGGGTCGAGATTACGGACGCCGTGCGCTATTTGGCGCCAGAGTGTGTGGAAGGAA
TGCTGCCAAACAGCAAGTCTGACGTCTATTCTTTCGGAATGACGCTTTACCACGCATTGGACGGAGTGTCGCCCTGCTCCGACATTACGAGTGACGAAGA
GCCGAGAACTTGCAAGTTGGCTCGTGAACTGCCGTCCCGGAATGTGCGATGTATTAGTGATGGCGCCTGGGAACTTATCAAGCAGTGCTGCGACCCTGTT
CCAAGTCAACGACCGACAATGGAGAGGGTTTCAAATGCGCTAAAATCGTTGGCGATCGAGCAGCGGACAGATAGTCTCACTAAACTTGCAGTTCCAGTTA
GCAAAGAGCCGATTGCAATCCTAGTTAACGAAGCGATGGGTGTTCAGACGCCCACAATGTACTAGCCCCGATCACCCAAGACGCAATGAAACTTTCACCA
GAATATGCGAACGGAACGCCGGTGAAGTCTAGAGGGACTCCAAGATCGTATAAATTCCGTGGAGCGGTATTGCTTGCTATCGTGGTGGTGATAGGCGTCG
TCGTTGGAATCGTTTTGGCTGTTAAACCATTTTCGGCTTCGAGCAATGGCTCCAGTACTGGGTCAGGCTCGGCGACGTCCTCCTCATCCAGCAGTGACAG
CAGCGCAGCAGGAACGACGGGCTCTTCATCTACTGATAGTGCTTCGAGCACTTGGACGTCTACTAGTGATTCAAGTACTGGATCTTCCGGTACTGTTGAC
CCCGTACCAACACCAACACCAACCGCAACTCCAACACCGACACCAACTCCTACACCCACTGCAGCGCTCCACGGTCTGCAAGTCTCGCTCTTGATTACTT
CCGATGTTGCAACCTCAATGGGAATTATTGGGCTTTGGGGCATTGCGCGTGCTTCGAATGGGGATATCTACGTCGCCGATTCGTTCCGAATTCTTCAGGT
CTTCGAAGGTAGTCCCCCTGTCGTGTATGCCGGCGACATCAGCAGTGGCAACCAGAACGGTGATCTCTTAACTGCGAGATTTGCGTCGCTGGGGGCGATG
GCCATTGCCCCTAACGGTGACCTCTTTGTTTGTGACAGCGACATGGTGCGGCGAATCTCGGGCAACACCGTCAGCACCTTCGCCACGCTCTCTCCGTCAC
GCCTTCACGGTATCGCGGTGGATTCCGGTGGGAATGTGTACGTCGCGGATGAAAGAAATACCGCTGTGACCAAGATAACCTCAACCGGAAGTGCTAGTAC
ATTTGCCACTGTTAACCTTCCAAGAGGTATTACGATCGGCTCGGCGGATAATATTTACGTCACCGACAAGAACCGAATCCTGAAATTCACACCCGCTGGA
TCGATGAGTGTGGTGGCAGGATCGACGGCGTTTGGGTCCGTCAATGCCGTGGGGGAAGCCGCGAGCTTCTACTCCCCCAGCGCGTTGGCTGTCGGCTCGG
ATGGCGATTTGTACGTCGCGGATGGAGGAAATAGCTACATCCGCAAGATCAGTCTCACGACCAGAGAGGTGACAACGTACGCGGGTACGTGCTACTCGGG
CTCGATCACAAGTGAAATTAGTAGCAGTGCCGCG