Description :
From Genome Similarity Track
Location :
Scaffold_101:119851- 124891
Sequence
5040 bases(100 bases per row)
AGTGGCATGTTATTTCTGATTATGACTTCAATTATTCTCCTTTCGGAACGGCGGTAGGTAAAAATGCTCCGCTCGCTGGCGCTTCTAGCCGACATTCGCC
TCTTCACGCCCAATAACGTCACAGAAGTCGCACTGAACCAAGCAGACGATGCCCTTTAAATAGCGTGCGGCGACCGACAATCCAAACTCGACGAGGCGCT
CCATCTGAATTGGAGTTTTGCGCACTGACATCCCGTACAAAATAACTAGGGGAGGCAACGACGGCGGCGGTCAAATAAGGAGGAGGAGGAGGAAAATCAG
GGCCCACGACGACAGAGGGCTTTGGGTTGGGTCGGGTCTCCCTGAGCGCGGAATTTCTTTCTTCCAGAATGAATGCAGAAGGAAGGCAGAACGAGAGCAG
AAGACAGAACTTACCTTCCCTTATTTTCGGCGTCAATTTTTTTTAAATTCGGTAAAATTGGCGTCTAATTATAGAATGTCGAATTTTATGAGTCCTGGCT
TATGCTATGCTCGCGTATCAATGCTACATTATTTCAATACTAATTTGCAACGGGAAAGGCTGCGAGCTAGGTGCCGCAGAGAAAACATATATCAATCTAG
CGGGTATGTAGGTCCTTAAACATCAGAAGCGCCACTAATTACTACTAATTTACTTTATAAGTACAAGGAAATTAGTTTTGTAGCACATATATTACCGTTA
AAGGGCCACATGTCAAGTGCTGGTGGATACAGACCGACAAAATCTTGTTGAAGTCCGTTTTGTACGTTTAATAAAGAGTGTATTCATTTCTTTAACGTAT
GACATGTATATTGGAGTATATTACAACGTCGACCAAATTGAATGTCTTGTGTGTGTTGTCATTACCTCTTTAACTTTGCAATTCCAGCTTGTGGTCCTTG
GAGGATAATCTTAACAGTACCGACTAATTCATGCAACAGCAATAAGTTGTCGCCATTAGCACAGATAAAGCCTTTTTGAATCGAAAAAAAAGAGTTAAAC
AGGCAGAATGGATTCATGATAGTTTATTAAATAATTAAAAAAGCTAAAATAAACTAAAGCGAAGAGCAGGAAATGAATTCCTATCCCACAAATAAACAAC
TATAACAGCAGTGCTGTAGTATCAGCAACACCACAGAATAGTAGCGACACCAAGAACACTAACAGCAGTAGCAATACAAACGACAATAGCACCAACAATA
CCAACTGTAGCGGCAGAATTATCAGAAGAAACAGGAGCAACATACATCACTTACAATAATAACAACAACGGCTACAGCCGCAGCGGTAGCAGTAACAACG
ACGTCAGCAACAACGAAACTAGCAATAAAACAGCAGCAACTGAAACAAAAAAAACAGTAATAACAATATGACATCAGAAAACAATAATAATAATAACAAA
AACGATATGAAAACAAAACCATCAATTACAACAACATCAGTACCGATTGCCTTCATCAACAGCCGCGGACTACAATACAAAGACATGTCCACATCTTCTT
TGTGCCGTCTGAGCCCGAAACTGGTGGCTGCGAGCGCAGCACGCCCATGGCAGAACCATATACGCGGCTCCGCCAGTAGGCGAGGGGTTCAGCACGGCCA
TTTAAAGGGAATTGAGAAGTGGAGTAAGGGCAAGGTACAAAATTTTATGTGTACCACGTTAATTAGAGTGTACGAGGACGTGGTGTATTTTTATTTTTCC
AATTATCTGAGACATTTTTATTTTTGTGATTGAATGGTACTTCTTTATTTTCCCATATTGTAATCAACAAGCATTTATGATAGATATCTGTAACGGTGCA
CCGCGTTACAATCCCTATTTCACCCATCCGAGAAAATATGAAATCACTTAGAGTTGGATCAAGAGGCTCAAGGCTACAACTGTGGTCCATGCGTGCTTCT
TTTCATCCTGCTGTTAAGTTGCAGTCGACGTCGAACCGTGCATATTTATGTAGATTCACCTTGCCTGCAGCATTTAAAAGTGGGTACGTGAAGTAAACAT
TGCAACTTTTCGCAAATCTTTACCACACGGTGAAAGCTAGACTGGCACAATCGAAGCTAGTAAACCAGTATGACGGACATAGTACAGTCTGGATACTGCC
ATGTGATCAAAACATGGGCATTGTACTATGTAATTGTTAAGCCGTACTCTACAGTCTACACTAAGTGCCGATTTGTCCACTTCTATTTTTCGGGTCTGTC
AGATGACGAGACACCATCTAAAGTAATGTTTTCATTCTATCCCATTCAGTCAAGCTGTTTAAGCTAAGTTACATAAAAAGATAAGAATGAGTCTTGCAAG
CTGGCATCCTCATCGACAGCATTACAAGAGCTCAATTACGAACGTAAAAGTTTTGGTTTCGGTGGAGTGAGCCCTCACCAATGGAAACGTGACAAACTTG
CGCAACATAGCAAGATAAAGCTTGGGTGAATGATGGTGTTCTGTTGACTGTTTGAGCCTACCCGAACTACTTTGTAGCCACAAGTCCCCAGCCTCCTTTA
AATCCATCACAAGGCTGACAGGTACAGCCTATGTGGTCGTGGCATAATACAAATTAGCATGAAGAGACTTGCGGACAAAACTTTCTTCCAAGATATTGTG
AAAGAGATTGATGTAACGGGGTGCCTCCGTTAAATTATATTTTTACATAAGGTAATATCAAGTATAACTGTTACGGTAAGACAGACATCATACTTTCACA
AAATTAGCCTAACATGTAATATTGTGAAGTAATACATTGTTCATTGGTTGACATAGGGAAAGATATCAACTAATAAACCCGAGCCACGACAGAAGAACGC
GATGAGTGGTGAGCAGATAGTTTCAATACATGTTTGTATTTAGATTTAGTTAAAAGAAGACTAAATACGATTTATTAACAGGAGATTAACTATACTAAAT
ACAGTTCTACTTTTACCCTTACTCGTGTTGGAATCTTCCTCTACACGACGCGTGTACATGATATTCCGAGATACCTGCTTACTCTGCGTTCAGAGTAAGT
AGCTTGTACTGTGATAGTACAAGCGATCGATGCCCTGGTTCTGGTAGCACTTTGTAGTCCGTTAACGACTATGAACATGCTGAACGATGAAGCGGGAGAC
TTCCATCCGACGCATCAGAGCTATTCCTATTTGAGTCAAATGTAATGAGATTTCGCCGGACGATAGGGCAAGGAGCCGTCTGCGCAATGCTGCCCGCTCT
GGGTCCAGACGGACAACATGCCTCCATCACTAACTTCATTCAGGATAAACTTGACGCGAACGGTAAAAAGGTAGCCTTGCTTCACCAACAATGGTCTCAA
CAGCCAGAGATGTTGAGAAAACAGATTGCTCAACTGTTTGAACTGTTGAGACGGCGAAAGATAACATAAGAAATAAAGTGATACGTACTTTTTTAAATAA
TTTTTTAGGAATAATATTAAAACGTATATTGATTAAAATCTTTTAAATTTATATCTTCTTAGGTAAATATTTCGCAGAAAAAAATGTTCTCGTGATTTTC
TAAACTTATGAAAAAGATAGTATAAAAAATATACTAAAACTAATTCCTATTTTATTCTGCACAACTTATTCAAAAATTAACAAATAATCAAAATTTGTCT
AAATTCCGGTTAATCAAAATTAATTTTATAAACTTGGTAGCATCCCACCCTCAAACCTTTTAAAATTTATTAATATTATTTTGTATTAAAATTATTTTAG
TTTACAAAAAACATACCGTACTATAATTTTATTAACAATCATTTGTTTTTCAATACAAATTGTTTTTTTAATACAACAAAATATATCTAAAACTCAAATC
ATACCAAAAGATCCTAGTTTCAATAACTTGATTTATTTGTGCATATTTTATCAAATTCAAAAAAAATTTCAGGAATTTTTACTTAAAAATAAAATATTAT
TTATAAGACTTTTCGCAACAGGGACGAAAGTCGGTCACACAGTGATCCAATAACTCTTTGTGGAAAGAGTATCGCTCAATGAATAAAAGGTACTCCGGGG
ATACTGTTTTTACTAAAAGGATTAGCATTAACTAATATTTTCGAATATTGTTTCTAATATATTTGTATGAAAATTAATTTTTATGGAATTGTTTATAAAA
GAGTTTCGGGTCTAAATTTTGTCAATTTCGCAATAGTTGATCTTTTTGACCTACTCCTACGTTGATTCAATATAATTGATTATGTTTATCTTTTTAAATG
AGGTTCTCTTTGAATAATATTTGGATCAATAGCTATCGAAGTTTACCTGTTTGTCTATCTCCAATAACTAATTCTCTTTGACCACGACCAATAGGAATTA
AACTATCTACAGATTTTAAACTTGTTTGTACAGGTCCTTTAACACTCTCTTTAGGCATGATACCGGGAGCTTTTACTTCTACTCGACTTTCTAATTTACT
ATTTATTGGACCTTTAGCGTCAATAACAAGTCGACACACACACGTCGACCCGAATCGCTGCAGATTCACATCTACATATACAAAAAGCTGAAGAAAACTC
TCTGTTGAGATGGTTTGTTGAGCTGGATCACGCAATAAATGATAGTCACATCGTCGATGAGCAAATGCAGGTCGCATTTGCTCAATTGAACTTGACAGGA
CGTGCGAAGACTTGAGCCTTGGGCCTCAAGCTCCACGTCCCATATGTATTTGGTTCATTAGGAGGCTTTAAATCACGGCTCAGACTACCTTCGAACCGCC
TTGAGCTAATTTCAGAGAGCCCTAACATCCTGAAACTCAAACAAGGCAAACGTGATGTACACTCATACATTCAGTACATACATCACCGTTTGAGTTGCAC
TACAGCGAATCCGCTGAATGAACAAACGTTGATCACGTTGTTCATGCAAGGTCTCACGGACGGTCCAGTCAAACCCTACATATTCCGAGTCGAATTTGAT
ACCCTGAAAGAGGCAATCCGGATTGCGGAACAGGAAGATTTCAGAGCGAAACAAGATCACATGAATTTGAATTCTTATCATCCTCCGAGGCGACAGGAAA
ATAGAGGCCCAGAACCATTGGACCTCTATTACGCTGAGAG