Description :
From Genome Similarity Track
Location :
contig_32:119848- 121249
Transcript NameFunction/comments
g7275.t1hypothetical protein

Sequence
1401 bases(100 bases per row)
TCATTTGTCCGCTACCATTCCGCGGAATAAAATTGTCGTCGCACGGTCACAAAGGGCTTTCATTCACGATACACTCCTGGCCAAAAGTATACGAACACCC
CTACTTTTACGAATAACTCGGCTTCTAGCCAGAGTTGAAGGCTGCGCGTTGAATATGTTTTGTGAAATACTGTAAGCGTTTGTTGGTTTGGACTAACGCT
GCGGATTTCAGCTTCTGCTGGGTACCTCACATACAAAAAACCACTTTTGGCTGGTGGCCAAAATATACGAACAGAAAGCACTGAACAACATCCCATACAA
ATTCCTATATTGATGATGGGTGCAGGAATGATGGTAACTAGTAGTGGGCCTTGTTGCCCTTCCTTTCGATGACTTCGATGCACCTGCGAGGCATGAAATT
GATCAGCGTCGAAATAGTCTCCGCAGATATGTTGTCCCAGGCCGTGTGCAGTGCCTTCGTCAGAGAGGTCACGCTATCGTATTGCCTTCCATTGCGGTAA
ACATCCCGGGACATGATTACCCAGAGGTTTTCGATTGGATTAAGGTCGGGCGATCTTGCAGGCCAATCCATCACTTGCACGCCTTGCTCTTCAAAAAAGG
CATTCGTCTCCCGCGAGGTGTGTATAGCAGCGTTGTCCTGCTGGAACACGAAATCTACTCCGTAGTGTAGGTGGGCGAAGGGAAACAAGTAGTCTGACAC
TGTGTAGGTATAGTGTTCAGAAGCTTGCCTACCAACGAGCACAGCTAGCTTGGTTTTCCCGGTGGTACTGAAGCCACCACACACCATCACGGACCCACCA
CACATTTGCCGCCTGTTTGTTTGGCGGGGAGGCTGGCGCAGATCTCGCCAGTAGTTCTGGAGGCCATCAGGACCGTCCAGGTTCCACTTCTTCTCGTCAG
AAAAGATGATCCGCGCCCAGTCGTCAGGTCGGATGACCATTGCCTTCGCCCATTTGAGCCTGGCCGCCTTGTGGGCCGCCGAGAGCTGCAGCGTATTCTC
CATCTTGGAGTAGACTAGCCAGTCTACTGCCGAGATGGAGCGCCGAACCGTGCGTGTGAAGCAGTCCAGCGACAGCTGGTCCTTTAGCTGGGTCGCCGAA
AGCTCTCCCTTGGCAGCCGTACGAACGAGGCGCCGCAGAGTTCTCTCAGACAGTACTTGAGGCCTCCCTAGCCTTGCTTCTTCTCGTTTAGAGTTCTTCG
AGCGTCGAATAACGCGCAGAACAGCTGGTGCGTCTTGCCGGCGATGGCGCGAACTCCGACTCCAGCTTCGTGCAGCCCTTGGATTCTTCCCTTCTCTTCG
TCAGTCAGCAGCTTGCCCTTGCCCATCAATTCGAGAAATGAGCGCAACGAGCGGTGCCCCCTGCGTCCCAGCCGGCGATCATCACGGGCCATTCAAAATT
T