Description :
From Genome Similarity Track
Location :
contig_32:119848- 121248
Transcript NameFunction/comments
g7625.t1hypothetical protein

Sequence
1400 bases(100 bases per row)
GGCTATCATTTGTCCGCTACCATTCCGCGGAATAAAATTGTCGTCGCACGGTCACAAAGGGCTTTCATTCACGATACACTCCTGGCCAAAAGTATACGAA
CACCCCTACTTTTACGAATAACTCGGCTTCTAGCCAGAGTTGAAGGCTGCGCGTTGAATATGTTTTGTGAAATACTGTAAGCGTTTGTTGGTTTGGACTA
ACGCTGCGGATTTCAGCTTCTGCTGGGTACCTCACATACAAAAAACCACTTTTGGCTGGTGGCCAAAATATACGAACAGAAAGCACTGAACAACATCCCA
TACAAATTTCTATATTGATGATGGGTGCAGGAATGATGGTAACTAGTAGTGGGCCTTGTTGCCCTTCCTTTCGATGACTTCGATGCACCTGCGAGGCATG
GAATTGATCAGCGTCGAAATAGTCTCCGCAGATATGTTGTCCCAGGCCGTGTGCAGTGCCTTCGTCAGAGAGGTCACGCTATCGTATTGCCTTCCATTGC
GGTAAACATCCCGGGACATGATTACCCAGAGGTTTTCGATTGGATTAAGGTCGGGCGATCTTGCAGGCCAATCCATCACTTGCACGCCTTGCTCTTCAAA
AAAGGCTTTCGTCTCCCGCGAGGTGTGTATAGCAGCGTTGTCCTGCTGGAAAACGAAATCTACTCCGTAGTGTAGGTGGGCGAAGGGAAACAAGTATTCT
GACACTGTGTAGATATAGTGTTCAGAAGCTTGCCTACCAACGAGCACAGCTAGCTTGGTTTTCCCGGCGGTACTGAAGCCACCCCACACCATCACGGACC
CACCACCCATTTGCCGCCTGTTTGTTTGGCGGGGAGGCTGGCGCAGATCTCGCCAGTAGTTCTGGAGGCCATCAGGGCCGTCCAGGTTCCACTTCTTCTC
GTTAGAAAAGATGATCTGCGCCCAGTCGTCAGGTAGGATGACCATTGCCTTCGCCCATTTGAGCCTGGCCGCCTTGTGGGCCGCCGAGGGCTGCAGCATA
TTCTCCATCTTGGAGTAGACTAGCCAGTCTACTGCCGAGATGGAGCGCCGAACCGTGCGTGTGGAGCAGTCCAGCGACAGCTGGTCCCTTTGCTGGGTCG
CCGAAAGCTCTCCCTTGGCAGCCGTACGAACGAGGCGCCGCAGCGTTCTCTCAGACAGTACTTGAGGCCTCCCTAGCCTTGCTTCTTCTCGTTTAGGGTT
CTTCGAGCGTCGAATAACGCGCAGAACAGCTGGTGCGTCTTGCCGGCGATGGCGCGAACTCCGACTCCAGCTTCGTGCAGCCCTTGGATTCTTCCCTTCT
CTTCGTCAGTCAGCAGCTTGCCCTTGCCCATCAATTCGAGAAATGAGCGCAACGAGCGGTGCCCCCTGCGTCCCAGCATGCGACCATCACGGGCCTTTCA