Description :
From Genome Similarity Track
Location :
Scaffold_139:119843- 123978
Transcript NameFunction/comments
Phyin_T30-4PITG_20383Putative uncharacterized protein
Phyin_T30-4PITG_20384Putative uncharacterized protein
Phyin_T30-4PITG_203853-oxo-5-alpha-steroid 4-dehydrogenase%2C putative

Sequence
4135 bases(100 bases per row)
AGATGGATTGTTAGTATAAAGTTTCATTTTAATGCATCTTCAGTGTTGTTGCGCATAAAGGCCCAAAGTCGACGACTTAAAACTCCTTGCCGCGCGGTGC
TCCGTGCGATGGGTACCTCTGTGGCGTCTGGATCTGGTGCAGCACACCCAGTCCGATATACGCCAAGAAAACGAACAGGAGACCAAAGAGGAGACCTGCC
ATGATGTCAGGGGTGATGTTCACATAGTGCGAGAAGCAGAAAGCTTTTCCCGCCGCGTTATACCCGACAAGGTAGCCTGCTTCGCACAACATGGCGGCAT
CAGCAGTAGAGTTCGTCCTTTTGGTCTTGGTCTGAGCAGCAAGGCGGCGTGGAAGAGAGTCTTGAATATCAACCGCGTTGGCGTCGTTGCCAGTAAAGGC
AAAGTCCGTCTTGCCACCCGTAGCAGCGTTGAGGCTTCTAGAGGCTGTCTCGATGGCGGAATCCACGTCGGACAATGACATTGATTCGGGCAGTTGAACG
ACCAGCAGGTCTGTCTTGCCGTTCGCAAGCAAAGCCTGTCCCTCCGCGGACGTGATAAACACATCCAAGTCCTGAGCCCCCACGATATGAGGCTTGACGC
TCGTTATTTCGGGAAGAAGTGGCTTCGATCGAGTAGTGTGTGGAATCACCACCGACGATACAGAGCCCTCAATTGCATTCTGCACATGTGAGCCCGCCCC
TCTTGAAAGAAGCGATACATCCTCCGAGGCCAGTGCCGGAAGAAGAAATAAACACATGAGTTCTGCCTGTTGGGAGAAAGATACTTGGGTGCTCAGCACG
CCCTGGCATACATTTAAGAGAAGAGCTCATTATTAGTTTGGTGACTGTTTAAAAAAAAACGTTCAGCCGCCAGACCGATGTACCTCTTTGTCAGCACTTG
CATCACGGTTCAGTACGCGCCCAACAGCGGACGCCACAGCGGCTTCATCCATCTCGGAGCTCAGGTAGGCGTTCGATCCAGCGAAAATACTGTGCATCAC
CAATACACGACACCTTTGTAAGATCTTTACGATGTAAATATACATAAGTTTGAGGAGAGGGAAACAAACGCACGGGCGTTGGGACCACATAAATAGCGGA
ACATGGGGGAGATGGCTGGATACCGATGCGGCTGACGTAGCAGCCGTCAGCCCGCACAGCACGGCGCCCAGCAACGTCTTCATCATCGTTTTATCGCCTC
TTCTTCGAAGTTTAGATCACAGTCCGTTTTTTTTGTTTTTATTCACAGGAAAGGTTCCAGTTTCAGTTGTCTCCTGAAGGTCGCATGAATGTCACGCGAA
GGAATCGCTCTTAAATGGAAACGATTTGTGGCCCATTTGTAGAAGAATCTCCCAGGTACGACACCCAGCTCTCCTCCCCATGCTCTACATGTGTTACGCC
TCCCCTTACTGTGCTAACCGCCGACCTTGTTGCTCTCTGCGCAGTCTATAGAGCCTCCTTCACGCCAAAGATATCGAGCAAAATGTCCTCTATTCTCGCC
TCGCTCGACATGAGTCTTGACGACCTGATTGCTCGCAAGAAGACCAAGGCAACCAACCCTGCCTCTCGCCCAGCTAAGGCCAACAAGGAAAAGGAGGTAG
CTGGTCCCGTTCGGAGCGGACGCCGACGCAACCGTAACCGTAACCAGCCATACTCGCGATCCGTAAGTGCGCCCGCGACCTGAAGGGCCGCCGCTTCTCG
ATATATTTTCTCCTCCTTGTCTCTCCTACACAACGAAGGCACACCATCGCCCCCCCCCCTACGTCTGCTAAGGAAAGACAAACAGTGGGTTTTCTCACTG
AAGGGGAGCATGGCGCCTGCCTGCCTGGTGATTGGGAGGACGAGCTTTTCGTTGGTGCCGAGATTTTTACACATAAATTTGTCTGCTGCTTCTCCCATGG
TATCCCAAAGCGCGGCGGTGACGATGACGACATGGACATCGATCTGGATGATACCCCGGACAGTGGCAACAACCGTGCCGGAAAGAAGCGCTCGGTGGCT
GTCAAGAAATCTGGAAAGGGTGGCAAGAAGGGTGGGATCTTCGTACCTATGCATCTTTCACTGCGAACGTTTGGGCGAGGCATTACTGACGCTCGCGCTA
ATGATTATCCTGACGTGTAGGCGGATCGTCCATCTTGTCACGCCTCGGTGGCAAGGATGCGGCTAGTCCTGGCACTAAAATTCTGGTGAAAAACCTTAAG
TTTGACATTCTGGAGGAAGAAGTGCGCGAGCTCTTCGGCACGGTAGGTGAGGTGTCCAAAACTGAGATCGTGTACGACCGCTCTGGCCGCTCGAAGGGCA
TCGCTCGTGTGTGGTTCGCTCGCCGCTCGGATGCTGACAAGGCCATCAAACAATACGATGGTAGATTTTATCCTTGTTAGTTCTGTCTGCGTATACTCTG
ACGCTATTGCGGTTTGTGCGCCATTGTAGGTCGCACGCTGGACGGTCAGCCGATGCAGATTGCGCTGGACTCTGACAAGAACGTTCGTAACGGACTCTTC
GGCACTGCCCTTCAACGCGACGATAAGGATGTCAAGTTTAAGGTGTCGTTCGGGTAAGAAGAAAGACTGAACTCGTGTCTGGCCTAAAACGGCTAATGAA
TGTGTTTGCTCCGTCAATAGTGAAGGCAACGACAATGAGCAGTCCAAGGGCCGCCGTAACAAACGCCGTGTGCGCGGCAATGACAGAGGCAGCCAGGGGT
ACGCTGCAATGATTTTGGCTGTTAGTAGATCAGGCTCTTAAATGTATTTGTACTGTAACACAGTGGTCGTGGCAAGGAATCTGCCCCGTCCAAAACTGCT
GAGGATCTGGACAATGAGATGGACACGTACATGAAAGACGCATAAAGGTGAAGACGCGATGCATCCTGCTGGCCGGATGCTTGATGCTCGTTTCCTCCGA
GTCTTCGAAAGTTCTACCCTGGCGACTATGCATAGTTGTTTTGCATTTTAACCGGTGCGCGTCGAGTGGGCGTTTGCATTCGCTTTGTTTTCGACAGTGC
GAGTGAAATTCCGCCGTGGATTAACGACTTCTTCGCGACACGTGCCCAATTTGAATAAAGCATCTCCATGAGCCTGAAAAATTGACCCCGGCCAAGATAT
TACTGAAGTAGCGCTTTTTCGCCGCGGAGTGAGCAGCGAACCAAGATGAAATGTTTGTGGTATAGCTCCATTTAAATCGCATAGTCTGCAATTACGTTTT
GTGCTCGCTCTACAGGGGGTAACATGTGCACAGTGGTGAGTGTCGTTTACTGCTACATATAGCTATACTACATGAACGTAGTAGTACTACACCTCAGCTA
GTACTACTACTAGTACTTCGAACAGCTCAGTGTAATAGAAAGAAATAATAAACTTTGAAGAATTAATATTAATACTACACTACGGAGGCAGAGCTGCACG
GCTTGTTGATCAAGGGGATCTTCGCGCTGGGCGCGGTGACGTTTATGGTTACAACGCTCGTCACAGCACCCTACGGCCGCCATGCCCGCCCTGGGTGGGG
GGCCAACGCTGGACACGCGACTCGGCTGGGTTATCATGGAGAGCCCGTCGGCCATTTGGTTCGCAGTCGTTTACTTGTGGGGCTCGCGGTTACCCCTCTC
ATCGCGGCAAGTCTGTGGGAATGTCATTACGTGTACCGTGCCTACGTTTACCCGTTTCTGATTCGTACAAGCAAGGATAAACGAATCCCGGTGACCGTCG
TGCTCTCTGGGGATTTCTACAACATGATCAATGCTTACATCAATGCTCGGTACTTAAGTCAGTTCGGCGACTACAGCGGGGACGACCCGTTTGTACGCCC
ATCATTCTACGCGGGGGTCGCTCTCTTCGTGTTCGGTCTATCGATGAACATTCACTCCGATCTAGTACTAATCAACCTTCGCAAACCCGGGGACAGCGCC
TATAAGATCCCATATGGCGGCTTGTTCAAGTACGTGTCGTCGCCCAACTACTTTAGTGAGCTACTGGAATGGATGGGCTGGACCCTGCTGTCCCAGTCAC
CCGCGGGTCTGTCGTTCGCGGTGTACACCGCCGCAAACCTTGTTCCTCGCGCCCTCAGCAACCACCTTTGGTATCAAGAGAAGTTTCGTGGGGAATACCC
GACCAAGCGAAAAGCTTTCTTGCCATTTTTGTGGT