Description :
From Genome Similarity Track
Location :
Scaffold_4:1198405- 1200891
Transcript NameFunction/comments
Physo_332525Hypothetical protein

Sequence
2486 bases(100 bases per row)
GCTACACCACAAACGGGTCTGTGCAGGGCACAGACACCGCGAAGATGAACGCAGAGGCCGGGCCTACTGCTAGAAACGAGCTGAACTCGTTCAACTCGGA
CGCAATCAACTTCGTGCAGCGCAGACAAGCCGTCATTCGGTTTGTCCAAGACGCTATTGCAGCTTCTGTTCATCGACAGAAGCTGAACACAGACAATGTT
GGTAGGGGCAACACAAATTAATTCAAGAAGGGTTCATTGGTTTTGTTAGCTACTCAAAACCTGCATAAACATGCAGTTTCCGACTTCGGGGCGAGCAAGC
TCGCTCCGCGCTTCATCGGACCGTTCACTGTGCTGGCACGGCACGGCAACGCCTACACACTGGACATACCGTCTAGTATGCGCCTCCATCCGACGTTCTA
CGTCGGGCGGCTGAAGCCATACCTGCAGCACGAACTACGTAGCTCGGCTGAACCGAAGCAGAAGACTCGGCGGAAGCCATCATCCTCTCCAGCGCAAAGT
CGCGCTCGGCCAAGCGTGCGACGCGACCTCCCACGTCGACAGAGATGTCCAACGCGGTCTGCGAGGCCTGAGCGACTTGATCCCTCAGGATCGCCACCTC
CTGCTTCAGAGCGGCGAACTCCCGGCTCTGATGCTGTTCCACAGCAGCGACCCGCTCCTCGAGCGTCGGACCAAGGTCAACCCCAGGTTGACCATACCCG
GGGCGTGTTCCCACCACCGCCGCCTCCGATCCGCGACGCCCGCGGCTCAACACGCTGGATTGTTGAGCGTATTGTGAACCATAGTATCCCGAAAACGAAC
CGGCAGCCGGTTCGTTATCGTATTCGTTAGAGAGGGTTTCCGCCCCACCAAGATACATGGGAGCCACGGGACGTCCTGCTGTAGGACGTTCCGGAAATGG
TGAGGGCGTACGAAGCTCACCACGCACTGCCGACGCGAAGGTAGTGCGAGCGCTGTGGTCACCTACAGCGCCCGAAGTCCCACGATCGTCGCGTTCCTCG
CGTGCCAAGAACTTGGCACGTAGATCCTTGAGACTCGCAGGTACACGAATCGTCGTGTACCCGTTTAGGTCGCGGTCGCTCAAGCGCGCCGCACCCGGAA
GACACAACGTGCACTGATGGCCTTCGGGCACAGCGCACGGAATACCAGCGTCCACAGAGGAACTGTGGAGCTGCTCCAGCCTCCCGCGCGTCGAGAATGT
CTCGAAGCGCTCACGGGCATGCTTAACCCGCTCACGGTAAGCGGCCGGCTTCTTGTTGAAGTTCAAGATGTCTTCTTGCTGGAGAAGTATCGGAGCTCGT
GGAAGAGCCCGATGTAATAATCGCGCCTTTGATTCGTTAACGGATCAGAGTGCTGCTCCTCCGCAACAGCATCGTCGTGGATACCGCTGCATACGTACAG
CGGGATTTCGTTTGGAGGCACAGTGTTGCCCACACGGTCTGCGATCTCTGACGCAGACGGCATCCACGGATCGCGCGCTGCCTGAGCAGCGCGCGGAGGG
CTTGAAGGCGCCACCTCACGCGGGAAGCGTAAAGCCCCAGCAGCAGAGAGCGGAGTGTCGCTCTCGCCGCGCGAACGCTTCGAGCTCGAAGCGTCCGAGT
TGTCTCCTTCACGAGGGCGTCTCGACCCGGCATGCGGGTCGAGACTATCACTGTCGATAGACTCCTTGCGCTTGCTAGAAGAGGCCTCGCCCTCTTCCAT
CTCCACGTCGTCGTCTTCGTAGTCAACGGCGTCGCTGACTACGGAAGAACCTTCGAGGACAATCTCTGGTTAAGTTGTCCCCGCCGCAGCCTTGGTAGCA
AGAGCGTCACGCTTTGCTTTGAGACGCTCGCGGTACTCGGGGATAGAGAGAGTATCTATCCCGGCGGAGGACTTCCCCTCTGCTGCAGCGTCGGTCTTCT
TCTGAGGCGAGCTCATTGCGGAATGAGCTCGAGTTTTCTTTCTCCCAACGTGAAGAATTGACGAATGGTCAATTTCCTGATTGACGTGCCGTGACTCGGC
GCGTCTAACCTTGAGGGGGGGATGGTGTAACAGGGTTACACACACAAGTGGCTACAGTCACTTGTAACTCTAACAGACACGACGTCTGTTAGAGGTTCGA
AATACTTTCTCGACCTTGGTGTAGACACACCAAAGGCTACATACATTTACGACCACCACGGCGGGTGGTCCATAGAGACTTATGATTCTTATTGGCTGAG
AGCAGCATCTCTTAGCCAATGAGCGACATGCATAGCATTGGAATTCTGCCAACCAGCCGTTGGCAGATTCCTATCTTAGAATATTACATTTAGAGGAAGT
CAGAAACATAAAACAAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAATT
AACTCTAGTTAAACTAAGCGACGCTTCCTCACATACACGCGCACAGGTGTAAGCTAAAGTAGTGAGCCAAAGTAGGCCCACTACAC