Description :
From Genome Similarity Track
Location :
Scaffold_362:11984- 13112
Sequence
1128 bases(100 bases per row)
GCTTGGTCGGCGATCGTTTCTCCTCTCGATCAACCTCGATCCCGCTATAGGAAGCGGCAAGCAACTCAGGAAAGGAAGGAACACACCCGGAAAGGCAACC
ACAGGCCTTGGATCAACTCCAGGCCGACCGATCGCAGCGAACAACCCTCGATCGGAGCGTACACTCGGACGCAGAGCGAAGACTACCGCGCTGCTCCACA
AACAATCCCCGCGTCACGCCAAGACACTCGATCTTCACCAAGTGCTGCATCTTCGGAGCCCCGAGAGAGCAGATCCAGCCCGCCGACGGGTACACAAGGT
GAGAACAAGTTCAGCCGATCACGGATCGTTGGGGGACCCCTTCGTTAGTCGGTGTCTGGGCGCTGGTGGGACGCTTGATCAGGCCTTAACCAGATTTTGG
CCGATCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTCTTGGGGACTCCGGATTTCACCGGTGGATCTTGGTGCGAACCGAGATCCACTAACAAAAC
AACTAAGGCGGGATCGGGCCGATACGCGTTCCCTGACTCGTCGATCAGGCTCGATCCGGACTACCTGGACACGATCGCGGACAAGGCCCAGATCGTGAGG
AAGAAGCTGAGAGCGACAGGCTTGGGCGACGAAGATCCCAGACCGCCGGCGCTCGACTGGTCTGAGGCTGACCTGGATCGTCAGTATTACTTGAAGGAAC
TGCAAGATTTCTTGCGTCAAGATCCTGTCATGGTGATCGTGCGGCCAGAGCAGATCGACGACCCGAAGGGCCCGATTTCGGCCCCCAGAGTGACGGATAA
CAAGCTGATGGCGGTGAAGAACCTACTCGGGCTGTTGAAGGAAGCCGGCTTCGTGGCTGGCGCCTTTGAAGCGAACGATCTTTTCGATCAAGATCTCGAT
GTGACCCAGACAGCGATCCAGACATTGGTCGACAAGTTGAGACCTTTCGTCGACGTGATCGCGGACAGTCCGGACCTGAAGGTGCCAGATCTAGTGTCGC
CAGCTCCCGCGTCGTCGCCGCGGATGGAGTCCACTGGGTACCGATCGTCGTCTCCTTATGTCTCCGCAGCGGAACATGTATCGGATACGTCGTCCGAACC
TCAACGGATGTCCCTCGGCCCTTCAGGA