Description :
From Genome Similarity Track
Location :
Scaffold_25:119826- 123796
Transcript NameFunction/comments
Phyin_T30-4PITG_12906Putative uncharacterized protein

Sequence
3970 bases(100 bases per row)
CTTCTTACGACAAGTCGTGAAGTTCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGACATCAAGTTGTCAACGAACAACTGTTCTTTC
TGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGACCGCCCACAACGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCT
CCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCACCACCGAACCCCCACGCACACGCTGGGCAGCTTAGAACTCCTC
CTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACGATAGCACCCTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGTCG
AAGATACCCCGATAGGAGCGACGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCTGTACGCTTCTTTGAGGGCTTGACACCTTCGGCTTTAGAGG
CCTTAGCACGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCACCGGCTTTGGGAGCGCCCTTAGCCTTGGCGGCCGG
ACTCTCGGAGCGCACATAAGTCCTGGGACTGTGATCACCTTGATCACTAGCGAGCGACTGCACGCTGTCATCTTTGTGCTCACTGGGGCACTGGGCTGTG
CCCTCCCACAGAGCCCGCAGGAGCATCGTGAGTGCTCTCGGACTCGGCATCGTCCTCACTGCCCGAGTTGAGCTCACGTTCCACGAACCGAGGGTTCGGA
CGATTGTCTGAAGATGAGGGCGACGGACTGCGGCGCTTGCTTGCGCGCTTGTCCACAGCGCATCACCCGAGGAACCGATCGCCTCGGAGGCCACCTGAGT
AGCCTCCTTGAGTGCCGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTACCGGCAGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTTGCA
GTGCCACGAGGCATGGTAACGGTCGAATTGGAGACCTAGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGCCGCGCTC
GCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACACCTCTTCATTCTGATTAGTCGGTAAACCGAACCTAAGTGGGGGGGGA
TGTAACGGGGTACGTAGCCCTAAGTGTACCCTGGTTACATGAGGCGTGACACTTCACACTTCAGGTGTATAACACGTCATACTCCGCGATATTTGGTACA
AAGTACCAAGGTCGTTCAAAGCCAACCATTGGTTAAACGACATTGCATTTCTATAGGTAACTTATAGTTTGTATTAAACCCAAACTTAGCCTACCTATAA
ATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTGAAATAAAGAGAGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCG
GAAGATAGCTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACAGTCCTAATTGCTGGAGCTAAGACACGAGTTTTTAGCTTAATTTGCCTCGCATAAG
TGAGAAGGACAGAAATGATGGAAACTTACTATTTTCTAGTTATTGATGTTGTCTGTTTGCTTTACGAGTAAGGGTTGATGTCAGTTGGGTCGTAGCTCTG
CTGCTTCAGAGGCTTTTATGCCTTCATTATTGATGCCAGGTTTTGCCATATCAAGGTAGCGCTAGTCAAAGTTCTTCTAGTTGCGTGTACAATAAAACTG
TCAGCGTGTTTTCGCCAGTCTTGCGCTCTGATGTGGTAATTGTTGCTTCAGCGTTTTTGAGGCCTGAAGGCTAAAGGTAATTCCAAACATCCTTTGAGCT
GATGCTAAATGGTATTCTATTTACCTGTTAAAGTCATCAGAAAACAAAAGCACATTACAGATATTAGAGCGAAGCCTTATCACGTAAAACGCTTAAAATG
ATGTTATTCTCAAGTGTCGTGGGATGGAGTTAACTTTGCATTGTAAAGTGCTGCAAGTTAGTATGAAGAGGCTACTATTGTAAATCATAGGGATCTTGAA
AATGCAAGAGGCTTTCAAAACAGTTTTGATGAGTTATGGATGTGGATAAAGATGAATTTATCATCGGACGTGACCTGTTGACTTCTTTAGGAATTGATGT
GGGCCGTCAATTGGAGCAACTTGCCTCTCACGTGGATGATGAAACGAGTGGAGACCCTTTCGAGTTGAAAGTTGACGAACCCCCTGCAAATTCCAGCCAC
ATGGCCAGTGACGAAGAAGTACGTGCTGTCGTTGAGGTTCAAATTGAAAGGGCCTGAAGAATAGATTTCCACCTGACAAAGTGGATAAATTGCGAGTGAT
TGTGCACATGTATGATGTGTGGCGCTTAAAGCTCCGTGACGATCCGCCTGCTCGTGTCCCGCCGCTCGAAGTGCGTTTGAAGGAGGGGGCCAAGTCATGC
AAATGTAAGCCCCGCAAATATCCTCCGCATGTTCGCCAATTCTTACGGGAGTTTAACACTATGCTTGTTGAACTAGGATGGATCTACGAGAACCCTACAA
GCCGGTGGGCAAGCCCCGTATTGCCCGTCAAAACATATCAAGATCTCATGGCTATGCGTCAAACTACGGACTACCGCGAATTTTATTCAAGTAAGACATT
ATGGCTTCTGTAATGCCGATACTTTCATTGATGATGGAAAATGTACCTGGGAAAAAACATTTTGGACTTTTCGATTTCATTAAGGGCTTCTGGCAGCTAC
CTCTTGCCGAGTTCTGCCAGGAATGACTTTCGTATATGACTAATGAGAAGATCTACACTTCACAACGTGTCCCTCAAGGTTGATGTGATGCTGCGATTTA
CTTTCAAAAGACAATGGAGAAGTGTTTTGCTACGCTGCTCTACAAACACCTTCTAGTATGGATTGACGACCTGTTACTCTAGGCAGAGGACACCGACACG
TACTTAAAGAAACTAAAGAAATTGTTTTCGCTGCTGGACGAGCTCGGCCTGAAGCTCAGCGTGGAGAAGTCCAAATTTTACCAACATGGTGCGGTAAGCT
TACCAATGCGCCCGGTGTGCGCCACGACCCTGCCTGGATTGAAACACTCCGTGCAATGCCATATCCTAGTACGGCGGGAGGGGCTGCAGCAGTTCCTTTG
CGCCATAAACTGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNGCAGCTGTCAGCAACGAACACAAGGAGGACACGAGTGCTGCTAGCTGCAGCCAAAGCCGGTCCAAAAGAGCATTTCAGACGACCTC
CACCTACCACGACAGTCGATGATACGGTGGTGGTACAAGGCGCAAACTCCTCTTCTACTAACGATGACAACTCCAGTATTCCCGTGTCCAAGCCAGCGGC
CTTAATCGAACAGGATAAACCTGTGCCTGACACCATAATGCAGCCGCCAGAAAGAGCAACCGAACGTGGTGAATTGGTAAGGAATGTACAGGTTTCTGAG
CCTCCATCTGTACCGAAAGACACGTCTCCAAAGAGATCCCGGAAAGCTGATGAAGCAGCGCTAAGTGCGGCTCAATCTAGCGCTCAAAAGAAAGCAAAAC
GCGAGGAAATTTCGACTCAAGCCAAGATAAAGAAACCAGCAAAGGAGTCCAAGGACGAGCGGAGGATGAAAAAGTCGCTCGCGTTATTTACACAAGCCAT
CGTTTTAAACAAAAACGAACAAGCTGACAGCAAGTATGCACGACGCACCATCACCGTCTTGGTAAGCCAGAGCTCCAGATTCCTGGATACTCTCGCGCAT
GTGGTACGTAAAAAAATGTGTTTCTAAGGTGTATGATACACTCATTCTAACGGTCAATAACGTTATATTC