Description :
From Genome Similarity Track
Location :
scaffold_1:11980- 15460
Sequence
3480 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNattcaacacggactcccagagtcgattgtctctgataaagacccccgtttcacaggaaaa
ttttggtcgactatcttcaaggtactcggcaagttggatatgtcgacagcggatcatccgcagaccgattttcagaccgaaagggtgaatcgcatcattg
aagacgttcgtCGCAGCATCTGCACTGAGACaagaggcgctggagcgccatgttgccactcgtagattttgcactgaacaatgcagtgcattcgtctacc
ggctacacgccgttctacgtgaacgggctgattccgCCACGCGTTTCGCTGACGCCGCAatctcatggctcagggcgtGTGGGGGAGGaacagccgaacg
gctagctgatgtcaccCTCCTCACCActtgcaaagaagtcgatgactttttgtctaccagactgagtgtccaacgacacgttcgcaatgcgatgactgaa
agccaagacctgcgaaaagaatatgcagataaaaatgaagaggcaaagtggaaagattTAAGAtcgggacctggttttattcagTTATAAAActctgcct
acacatgcagcctctgctatcttccggacgaagcttcgtccagggTTTATTGgcccgtttaaggttgtggccaagcggggcctagcgtatacgctaaatc
tcccaaaacggatgcgcacccaccccgtgttttacgtggggttgctcaagccgtaccgggatccggcgcaagtgaacgcggaagcgttggcgtcaGAGCa
aatcccacgggccctcggccacccagaagctgaaccagcaactggttctgagcatggaGNNNNNNNNNNTatcttcatcgattccggaccgttgggcaat
tatgcttgtcGCTttacgatggaaggaagtcgtctgtatgctgaggcgctgaaagcgcgattgggtgacatcgtcactgtttgcataGCGCAGGGACAcc
tgtcacggtcccgaaggaccctgtggacctcggagtcaactTCCTTGActctgatagcgtggaacgctgtttaGTTTTAGACTCGGAGGTATgacctaga
aaggatgttcttcagtacaacatggtgggatgtacgaagtacattgcactcgacttggtcgatgggtattactaaTTGCTCATGGGAGCGAGCGATTTTT
CGCTAACAACGGTGAGCAATCCGCGTAGCattctctgggagtggctggtgatgccccaagggctgtcgaatgcaccagcaagattttatcgtcttgtgac
gcagttgttcaggtcccacaGGGCGCATGCACAGTCATACGGTgaagacattttcgttcatagtcctCCGGAGcgcggga