Description :
From Genome Similarity Track
Location :
Scaffold_54:11980- 13943
Transcript NameFunction/comments
Hyaar_Emoy2806676NADP-specific glutamate dehydrogenase, putative
Hyaar_Emoy2806677NADP-specific glutamate dehydrogenase, putative

Sequence
1963 bases(100 bases per row)
CTGTTTCGTCGCGGAGGTGACAAGCGGTTTCGCAACGGCCAGGAGGCTGCCGACATGCTAACAGACGAGGTGATTCGTCGTGATCCCAACCAGGTACAGA
ACCCCCTCATACATCAAAATGTAGCTCTTTATCTCCTCTTTCGAATGAGCTAACAACCACCATCGTCCGCTTCCTACAGGAAGAGTACGTACAAGCCGTG
CAAAACTTTGTCAATTCCGTGGTACCCGTTTTTGACCGGTACCCCAAGTACGCGTGGGTTATGAAGACACTCATGGAACCAGAGCGTGTGATTCAATTTC
GAGTGCCGTGGATTGATGACGAGGGAAGCAGCCGCGTCAATCGTGGCTTCCGTGTACAGTTCTCCAGTGCTTTGGGTCCGTATATGGGTGGATTGCGTTT
CCACCCAGAGACGACACACGGTATCGCCAAGTTCTTGGGCTTTGAAACCATCTTTCGCAATGCACTGGCCGGTCCCTACGGTGGTGCGCATGGTGGCTCG
GACTTTAATCCAATGGACAAAAGCGAGTCGGAGATCATGCGCTTTTGCCAGTCGTACATGACGGAATTGGCCAATTACATTGGTCCGCACACGGATGTAC
CGACATCAGGCGTAGGTGTTGGACCACAGGAGATTGGCTACATGTTTGGACAATACAAGCGACTGCGTCAGCTTCACCCTGGAGGCACTGAAGGGATTCT
AAGCGGAGGTGCTTACCATTATCCACAGGCTACGGGCTACGGTGTGGCCCACTTTGCCAATCGTATCCTTGAATCCCGTGGGGAGTCAATGAAGGGAAAG
CGCTGTCTTATCTCGGGTAGTGGCACCGTGGCGCTTAATGTTGCGCACAAGCTCTTAGATCTAGGCGCCATCCCGATCGGAATGAGCGACAACTTTAGCT
ACGTAATCGAAGACCAAGGGTTTACGAAGAAAAGTCTGGCGGAGCTCATGCGTATCAAGGAAAAGCGCAACGCGCGTCTTGGTGCCTACATCATGTCGTC
CACCACGGCCAACTACCACCCGATAGAGGAAGGCCGTCTGTGGGAGACACCTTGCGACTACGCTTTTCCGTGCGCTATTCAGAACGACGTGGATGCTGAT
GATGTGCGTCTGCTTGTGAAGAACGGCTGCAAGGGCATCTTTGAAGGTGCCAATTTTCCTTGCACAGACGAGGCCGTAAGTCTCATTAAGCAGCACGGTC
TGGCCTTCGGCCCGAACAAGGCTCTAAATGGTGGCTCCTTCGCGCTGATCACAAAAAACCTCGGAGCGTCCACGCAGCTATCTGACGAGGAGGTGGACAC
GATCGTCAAAGGTGCGATGTTATTATAATTTTTGTGTGTGATTCGGTTTTCTAACTAGGTGTGAGTTATCCCACTTATGATTGTATAGAGTACATGTATG
AGCTCTACGATCGCGTGGCAGCTTCTGCGCAGGAATTTAATGCCGCAGGCGATCTCCACATGGGCGCTAACATCACGGCTTTCATGAGCGTGGCTTCTGC
CATGTTCCGCCAGGGTGTGGTGTAAATCAGCTCCCAGCAATGCGGCCCATTTGTTGCCCTCAGATAGAAATCTGGCAAGTCGTAAGTCGCAGCTGAATTG
TGAGGTAGCAAGGTGCAGGATCGTGATGCCGGACAACGTTTCTTTGCAGACGTGATTTACTCAGGCTTGACAACGTTTCATTAATGTAGACGTGAATTTA
CTCAGGCTTGACATAAGCATGTGAGTTCTGCTACTGAACCGCTTGACGGCGCATGTTTGTTTGAAGGGGTTATTGTCACACGTTGAGTCACGTCGTTAAA
TATAAAGAAAGTATATTAAACAGGCGCAACAACGTTCCACAAAAAACGACACGGGGTGTCGACGCAACTCGGACTGTCCGGCATCTAAAATGTGCTCGAT
AGTTGAAAGCGCTCTACTTTAGTGACAAGCTCTCGACTAGGTGCTGGAAGGATTCTTTGCCAT