Description :
From Genome Similarity Track
Location :
Scaffold_1494:1198- 2607
Sequence
1409 bases(100 bases per row)
AGCTGCTGATCTGGGTGGATCAGCACACAGGCTTCGTGATCGTCAGCGCCACCcGCAGCAGAGAAGCCCAAGAAGTCGCGGAATCCTACGAGAAGGCTAT
CTATAGACGATTCGGGGCGAGCGAGATCGTCAGACACGATCGCGAACCGGCGTTTATGTCAGAAGTGTTTTGGTGGGCTCATCGGGGCACGTAGCAAAGC
GACTCTGGCCTATCGCCCACATTCTAGGGTTTACAGTGGAGATCAAGTCTCCAAGCTCAGTGTCAGCGGGCCAGAGAAGATGTCAACCGACTGTTGCGTG
CaGCTATGGAGGAaCGGtGTGATCAAGCCAGTAGCGAGAAgCGAGGAGATGctAaCGCGATCGTCgAaGGTGCACGAGTGTGGGTTTACGTGAACCAAGT
GAGgCCGGGgTATGCCAAGAAGCTCGCCCACCTGTGGCACGGCCCCTTCAGAGTACTGGAGCGCCTTGCCGATCACGTGGTACGACTCGAGATTGAAGGA
aCCGGTtAtCGTATGTTCCCCGTGGTGCACGAATCTCGCCTGAAGTTGTGGAAGGAGTATAGTAGACAGCCAACAGGTGAGCTCGAAGTGGCCAGTGAGG
ATCGtCTCGACTTCGACGAGGCCCTTTTGCCTGAAGACTCATTCGAGCCGAACGAAGACGCCGGTGATTACGAGATCGAGGCCATCCTGGATCACGAAGA
GGGCCGAGCCGCTCGTCAGGGCGAGTCACGAGGCTACGCCGCGCCTAGCTGGGTCAGCGAAGACGATCTGCGAGCACCGAATCTCTTGGAGGACTATGAG
TCGAGAGTCAAGGCAATGGGGCgATTCTCCGCGATGCAGGTGGAGGAaGAGTGACGGCAAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGATCATCAACA
TTTGATCATGTTCAACGGACAGAGAGAAGTTCAAACGCTACGTATGCAGGCCACAGCGGGGCAATCATATGGGGGCGGGTGCGGTCATCTCAGTGCGATC
GTCACTCAT