Description :
From Genome Similarity Track
Location :
Scaffold_47:119782- 120903
Transcript NameFunction/comments
Phyci_225976Hypothetical protein
Phyci_126835Hypothetical protein

Sequence
1121 bases(100 bases per row)
GTTATTTACGACGGATTGACAAGTGACTCGACACCGTATATCGAAGGTCAAACCAGCTCCTCCACAACGCAGTTCAAGTTCTCGGCTTCGACAGCGAACA
TGGTGGCCATGTTTAACCCATGGATGCAGTGGCTTGACCCAGCAGCGACCAAGTAAACCCCACATCTCTTTACAATGTTGCGTCGTAACCCAGTTGGTTC
GTCGAACAGAGCGACTACATGGAGTTATCTATCTTGTGACAATTCTACGAAGAAGGTAGGTAGCGACAGAATTTAGTTTTTTGCAGCGTGCCAATCAATC
TTTCAAAGCTAATGATTTCGCATTCCGGCTTTGCCCGCAAAGATCTGATCTTACACTACTCTACGATGAACGTTACGCTAGACACGAAGGGGCTTAAAGC
TGATCAGCTTGGTAGTCTTCCAGTTCGTAGTCGCCTTCACTCGAACTTCAGTCATCAAGCGAACCGCTGATGGGGCTAGCTGCCGACATTTGCTCCGTCA
GCACTTCCTGGAGGCGAGTCACGTATTCGAAGCTTGTCTTGCAGTCCAGCGAGCAGAAGCGACTTGGACTACTGCTCAGTCTCGACCGCGAGGTGAAAAA
TAAGCTGCCGCAGTTCATGCAGTGCGTCTGACGTCGTTGCCAATTGCAGTCATAGTACTTGCCTTCGACAGCTTCTTCGCGCGTCTGCTGGGATTGTGTG
CATCGAAGAGTCGAGGAGCTGGTTCCTGCAGGAATAATAATGCTGGCGCTGGCATGGTGAACGAGGTTTACTGGAGTGGCTGCAGATGGTGGCTCCGACC
ACGACTTGGTTCGGCTTTCCCTTGTGGGGCGTCTTCGGGAGAATATGGGCTCCATCGTGCGAGATGCAAAACTTGGACGGCGCGCGAGAAATGCTTTTGA
CTCGCTTCGATGCCCGTCGTGGTGGAGGTCTTGGTTGTTGCATAATGCGTGGTGGATCATAGAGTTTGGATGCTGGAGTGTGGTTGCTCCACTGCGAATT
GAGAAATGCTCACCGATCATTGCAGACTTTCCCTGAAGGCACCCGGCATTTCCCCTGGTCTCGGCTAAATGCGCGCTATCTGTACACAAGCAGAAGAACA
TGTGTTGTGTCGCGAATCGAG