Description :
From Genome Similarity Track
Location :
Scaffold_104:119764- 123073
Transcript NameFunction/comments
Hyaar_Emoy2809582hypothetical protein
Hyaar_Emoy2809583GK15001 putative

Sequence
3309 bases(100 bases per row)
TCGCGTTCGCTCGCGTTGGACTGCGGTTCAAGATGTGGGCGGCGTACTGCACCGCGTCGCCCACAACTGCAACGGCAGCGCGCACGCGAACATCATGCTG
CGCGCGAGGTTTGGCACCGCCCTGTGTATCCTCTCAGCCTTGCCGTTCGATGCCTGGCTGTGCGCTTCCGACACTTGGTGCGCGATAACCGTGCGCTTGT
AGAATAAGTCGACGTAGGCGTGCTCTTCACCGCCGTCCGTTCGCAGCACGTGGACCTTGAAACCGAAGAGCTTCTCAAAGGAAACGAGGAACGCTTCACG
CCGCGTCCTTCGTGTGCGAGAGGAACACGCGGCAGTAGTTCTACTTATGGTCGATAAAGTTGACCAGATATCGATTGCCGAGGCGATCCTGCGGCGTCAT
CGGCCCTTAAGGTCCGAGCAGATGACGCCGCCGATCCTGTCTATCGGCGAGTTGGCGCCGCAGTCTTTCTGCGACTGCGCGTTGCGCGTCTGCTTACCCT
CGAGGCATGACACGCACGCCATGCGCATCTTGCTGGGCAGTCGGATGCCCGACGCTGGACCGCGCGCCATATGCACGATCATATCGAACGCGAGGTGGCC
GAGTCGCTGGTGCCAGTGCAGCAGCGAGGCTTCATGCCCGTCTTCCGTATCAGCATCCATCTCACGCTCTTCGAGCGCGGCCATGATCACATCTCCAGCG
CTGTCTCCCGCGTGTCGCTGTCGTCTCAACATACAACACGTTGCTGTCGATCGCGACGTCGAGCGCGACTGTACCATCGCTGCGCCGCGCCAGAGCGCGT
TTGTTCCTTCGTACACCAGGGCAAACCCTTTGCTCTCCAGATTCCCGTACGAGACGATGTTCTTCGCCAGACGGGGTGCAAGATAGACTTTGGTCAGCAT
CACAGTCATCTTTGTACCGCGCGCGAGGACCTCGAGGCACACACTCCCGACACGCGTCAGGCGCAGCGACTCACCATCTGCCATAGCTATCTCGTGGACG
CAGGCAGTTGAGTCGATTAGCGGCGACTCGTCGTCCACGAGGTGTCTACTTGCACCACTGTCGAGGATCCAATCGCCTTGATCGATGCTAATCGCATCGT
TTGCGGCTCGCTTGAAGCACCCGCGTAGGCGCAGCTCGCGCGTTTTCGCTCGCGTCTAGGGCCTCGCAAGTTCTTCTTCTTGCTTTTGACTGCTTTAGTG
CGAGCCGCTGACGCTTTCTTTGTATGCGAAAGCACCATGTCGCCGCTCGTGTTGCTCGTCCCGTCATCAAACACGACCCTTGTCTTGCAGTCGGACACAG
CGTTCCCCGTCCTGCCGCAGCGGAAACACGTTCGCGTGTCTTGGGGCTTCGTCTCGAAATGCGCCGCAACAACCTCGCGACTGACCTCGCCGCTGCCGAG
CTCGATCGACTGCACAAAGTGCGCCAACTCCTCAGCGTGGTGCAGGCAGTCGAACCTCATCGGTTCGTACTTTGCCCGCATAAAATTCATCAGCTATGGC
GACGCGTGGTGCACGATGTTGTTGAGCATAAGCGAGTCGGTGCCACCGTCCGCGTCGCTGACGGCCACCATGTAAAGAAAGCGCTTGGCTCAGGTGCGTC
GCGATTCTTTCTTTGTCATGAACAGCTTCATGGCCTGGCTCGCCGTTATCGTCGTTTTGAACGCCACGTGCAGCTGCTCCATTACATGCTCAAGTCTCGA
TTGCTTAACCCACCAAGTGTCGACCTGTTTGTGATAGCAGCCAAGAAGTGGCCGAGGAGGTCGACCTTCGCGTCCTCCGTCCACGTGAAACCGCACGACG
CCTCAGCGAGGCTCACAGAGCGCATGAAGGTGCGTCCCCAGTCAAAGAACCCGCTTTCGAGTCCTTTGTAGAGATCCATCCCATCAAACTTGCGAATGTT
GAGATTTCGCTGACTCGCGGTCGGCATTCCGTAGCTGCCGATCGCTGCCACCGTGTGCGTCGCATGTGGCGGCTCTTCTTGACGCGACGCGATCATAGGC
TTGGCTGCTCGTTCCGGCATGCGATGCTGAGCTGACGGCTGTCCACGCGGCGGCGCGAGCGAGGCGAACATCGACTTGTCATCATCTGGCCAGCTAGCGC
ACGCGCGAGGTGCTGCTGGTTTCTCCTCCAGCGGCCCAAGCGCGTCGATGGTTATGGGGTCCACGCATGTTCGCTCCAAGCTTGGACGCAAACATGCCGC
TCTCGACAGATCTAAGCATCCTCTCGTCTTCGTCCCGGACGGGCTGAGAAGACTCGAGCTTCGACAGGCGGTCGGTAACTGCGGCGAGGGCCGCGAGGAT
TTTTTCATTGGTCGCCTCGTCCCTTTCGCGAGCAGTTCTTCGAAGGCTGTTGGCGTGTTCACCGACGAATGCACACGCGCTGGCGAGTCACGCCTTGGGG
TAGCTCGCGCGACACCACCTGGTGTCTTGCCGGTCGCTTCAGTAGCTCCTGTTATTGAGCTCATAACCTGTTGGCACGCAAACGTGCAGCGCAGTAGGAG
TTAGGTGAAGGAAAATAAGATTCTGTATTCAGTATACTACTTACCGCTCTGTCTTTTTCCTATGCATGCACACTGCGCTCTCTAGAGATCTTTTCGCACC
TCATTGTACAAATGGCTCGCTGACTACCCAGTTGACTCGAAACGCCTGGCGCAAAGCGAAACTACAAGTCAGAATGCCTGACCTACCAAACAGCACACCA
CACGATTTCCTACAAAGTCTTCGTCACCAAACTTGTTGTACGCAGCTTGTTGCACGTGGGCATAACACCAGATGATATAACAACCGAGCTTTGCGTCGTT
GTGGAACTGCTGTACAATACCTGAGATGTGGTCGGTCATCTTCTTCCACGATCAGTAGGGTTGCGCCGATAAAGGTTTTCTTCATAGCGGGCACAAAATG
TTATAGGCCTTTCTTGTGGATTAAAAGGCACTTGTGCTGTGTAATTTCAATACTTTGGAGCACTACAATATGCTGTTGACGATTCCTACATTCTGCTTGT
AGAGCTACCGAATGTAGCGGTATGACGTGCTTTTGTAGTTAAACCGTTCGAAAGCAATCAAGAAGATTCACGCTTCTCTAAGCAGCTCGGACCCTTTTTT
AAATTGACTGGTCAGTCGATTCGGACGCTTATCGGGATTGTAAATTACTACACGCGCTGATACAGGCCAGTCCGCTACGCTACTAGACGTGCAGCAACAG
TAGGCAGTCTGAAGGAACGACAGTTCTACCGAGAAGGAATCAGTCGTTGGTAAAAACTGCAGCTGGTTCTTGACACTCACATAGCAGCGATTGTGTCCTT
CATATCCCC