Description :
From Genome Similarity Track
Location :
Scaffold_123:11976- 14733
Transcript NameFunction/comments
Hyaar_Emoy2810316hypothetical protein
Hyaar_Emoy2810317bifunctional reductase

Sequence
2757 bases(100 bases per row)
GGGTTAACACGCGCAGCTGCCTTCTCAGCAGCTTTCGCCGCGCATCGCATGAAATTGTTCACCATGCGACAAAATCCAGAAATGGATGGATCAGACCAAA
ATAAGTGATCCCTGTCCCTGATGTGGTCTAACGGTGACCACATCAACATGATAGTGATTGAGTGACTATCGTTTAACGGTGGGGGGGGTGATGTAACGGG
GTGAGCCTGTTACATGTAATTAACCCTTGATACTTGTTGATTAGAATATTATCATAAAGGTTGCTATTGTTCGTGAATATTACCATAAGGGGTAATATTC
AGAAACACTCACCGATTGGCTGATATGGGTCGTCATATTAGCCAGCTCTAGAGGTCCAATCAACGATGGACGCGCGCAATGAGTGGTGAGCAAGACTTTA
GCATACATTTTTGTAGATACATATAATTAAGCTAGGACTAGAACATAGGTTAATGATTAGGACTTAATTATATTTAATACAGTTTTACTTTTACCAGCAA
CTGGACTGTCTCTAGTTGTTTACCTTCCTCTGCACGTTTGCACAGAGGTAGCGAGGCAGCACTAGCACTGCTGTCGGTGATATTAGCTTCACAATGGTTG
TCCAGTGTGTTGTTCCGGTGCCCTGTTACAACCAATACAAGCAGCAGAAAAAAACACAAACAACTCACAACATTACCAGCAACATGTACGGCAACAGTAG
CATCAGTAGAAACAATGGTAGCGGCAACAAAAACAACAACTACAATAATAACATTAGCAACAGCAATGACAACAACACAACAATTTTAGCAACAACAACA
TCAGCACTGACTGTCGATGTTTACAACCGCAACGACAATTAATGGCGCGTGTCGCGTCTTTTCCCTTGCCGCCTGCGCCCGCAACTAGTAAGCGCAGTAC
GCCCACGGCAGAACCCCCTCAGGCTTCCTATCGGGGCTGCCCCTACAGGGCGGGGGTTGAGAACGACCGTAGATTTTCGTAACGAGGGGAAATGCCTAAA
TATATGGGGGTTTACGTAGCCAGGTTAACATGAGTATATTAAGACATGGTGTTCTTTTTTCTTTTAATTATCTAGGGCCTTTTTAATTTTTATTATCTAG
GGCAATTTTTCGTGATTAAATGGGGCATTTTATTTATTTCCCCATTTACTTTGTGGCAATTAGACTAGGCGGTCTAAAATTGGGATAAAGCTTGATAATG
CTGGATTTTCTTAACATTCTGAATAGGAGTAGAACTTGCGTAACCTTTCCTTTTTTAGAAGATTCCTAAATGTAATATCTAGACATCCATCCTGCCGTCT
CAGTTTGTTTGAATTCTGCATTCTGAGACCAGGTGCTTTTATTCGGCGGTATGGTAAGCTGTGTGGACACTTCTCTCACTCATGGAAACCGCACCCGGCA
CCTCTGTCAGTATATCAGATCTCCTGCTATCTTACCACTTTGTCGTGCTTACCATAATGGCCTTAACATGTTGCCGCATCCCTTCCGATCCATTACTCCT
CGAATCAGGTGCTGTTGTTTCGACCGACCTGGTGTTCGAGGTATAAGACGCTGACCGCACGCGTCGACTATTGTTGGGACTCGTATGAGACTTGTACAAC
TAGTTGATGTACCTTCGAAAGGTTTTTCTTCCGTTGATCTACACTGTGGCTTTTTTTGACCTCATCCTGAACAGTCCGGTAGAAGACGAGAGCGCAAACT
GCACAGAGGATCGCATAGATGCAGCATGACCGTGTTGTACGACCAGTACTTTCATAGATGTCCACAATATGAATTGACATAGCGGCTTTCGAAGACCCGA
TGGTTCTAACGGCTACACACACAATTGCACAATTTTGTACAGGTGCACTACTTACATTCCAATCAACCTCTTTGCATGATACGCTTGAACAACTTTTGCG
CAGGCTTTGGCCCCTTCGACAACGACAATCAACTGGTTGCTTGGGTCAGTACTCTCCTCTGGCGAGTCAATCTCAGAATCATCCTAAAGAAAAAAAAAAC
AAGGATCCACTGTGAGACAAAAACACAACCGTATCATCAAACATACTGAACCCGTACCTTGAAGTAAAAGACAAGCGAATTATCCAGACCATCCCGTTCG
CCAATCTTTGCGAGCGACGTTAGTGGCCGCCATTCTTCAACAAGCGCAAATCCTTCTTGCGTTGCCGCCATCACATCCAGAACGACAAGCAATGACGGAG
TGACAACCAACTCCCGGTGACCCAATCGAATCAACTGTCGAGGAGACTGTCCCCCCTGCTCTTCAAATTTAGTGACATGATAGAAGCGAAAGTCTTGGTG
AACATCATTCAACGAAGACTTCCAGTTCGCCAAGTTCACGGATCGCGATTCAGGTAGTGTCAACTCGCACATTTTGTTGTCTTCGTAATTTTGCAGTTCG
TCAGCGTCGCCACCATCCATGTTGTTCAACGGTACCTCATCCATTTGAACCTCGACCTCAGGATTGCTCGAGAAGTGCGGGCTCGATTTCAGCCGGAGAG
CTGCGGCTACCGCTTTGTCCAGAATAGTGCCTCCAGCCCGCGCTGTTGCCCGTCGCGGCGCTCGTTCTACCGAGCGCCGTTTAATCTCATCACTGCCTAC
AGCTTGCCAAGTACCCGATGTCCTTCCACTTTCATTATTGAACGCGCTGCTCACAAAACTTGTGATACCAAGAAGTGTGCGGCAGCTTTTGCTAAACTCG
CTGTATGGACCCCACCTGTTGTCTTCTGTGCCGCTGCGAATACGAAAGACGTACAGC