Description :
From Genome Similarity Track
Location :
Scaffold_450:11976- 13850
Transcript NameFunction/comments
g8141.t1hypothetical protein

Sequence
1874 bases(100 bases per row)
GTTATGTCCGGTTGTGTTCAGAAGACATCCACCTCCGGATCGAAGTGGATACATGTCGACCTGATGAGTATGGCGTAATCATTTATGCCGACCTGATCAA
GATCGATATTGCGCAATCATTTCGATATGCAATCTGATCCAGATCGACATGCGACAAACATTTCGGTACACGATCTGTACTCACAATTATTGTGGGTACA
ATGGACCAATCTTTTCGACACGGGTACCGCGATCTTGGTACATCAGACCAAGTTCAAGCTATGGTGTGCAATCAAGGGATGCGCAAGCGGGATAGGGAGA
GAGCAGGATAGGGAGAGATCTTTAGGACCTTTACTTTTGGTTAAGAGATTCTGATTGCCTTGCAAGACACAAGTGGCGTCCATACTTTCCGGGGAAGGAA
TTACATTGGCCTACGCGACGAAGGACCCGCCCAGTCAACTAAGGACACGACGCAGACATGGATAGCTTGGCCAGGGTGCGATCGCATACTCTCATCTCAA
CTCAAGACTCCGCCAGAGGAGGCGGCAAGCAACGGAAAGGGCTACAACAGCACACACACACACACCCCACGTGATCGACTTGGCCCAAGACCCGATCACC
AACAACCGACGACCGCGTGAAGGATACCCGCGTGGCCGTCACCCACCCATTCCCCGGAAGGAGCAGTCCAGCTCCAACCTCCGCCTTGGTCACCCACTGA
CATCTTCAGGGAACACCGGAAGAGCGTAACCCGCCCCGCCGTCGGGTACACAAGGTGAATACAAGGTTCCGATCACGCCTGATCAACGGAGTACCCCCTC
CGATAGTCGGCAGTCCGGGCGTACCGCTGGCAAGCTTGGATCGCGTCATCGATTTTCGCGATCCCGCTCCGCCACAATGATGTGACCACCGAAGCTCAGA
ACGAGCTGAGAGCCGAGCAATCGAGCAACGAGGCGGATCCTGGCGCTCCGAACGCAGAAGACGTTGACCCTGTGGTTATACAGAAAGAGCGCCGGAGACG
AATCTCCGCCGCCCAGGATGAAGAGCTGAGATGGTCGAACCTAAAAGCGGTCCTCCGAGGCAAGGAAACAGACCTCAGCTACAGAGCAGCCAGAGACGCT
TGGAAGATGGCCGACAAGTTCGTGCTTAGCGAGGATGGTGTACTGCATTTTCTTGGAACGAACCGTCGGTGGGGCAACGAACGCCGAGAGGAGACAACGA
TGCGTCTAGTGGTGCCCACAACGATGGTTCAGGAAGTACTACGGAGTTGCCATGACTCGTTGGAAGGTGGCCACCAAGGTATCGGTCGAACTTACCACCG
AGTCAAAGCAGACTATTTTTGGATTGGACTATATGCAGACGCCGAACGACACGTCAAGTCCTGCCCCGACTGTAGTTCGAGCAAAAGTCGACCACAGTTC
CGAGGCTATTCGCCAGGAAACGTCTTGGCCGAGCGACCGTTCCAGATGGTGTCGATGGATTTCGTCATACCGTTACCGAAGTCTCGTCGAGGCAATTAAG
CTTTGTTACTGTTCCAGTGCGCGTTCACAGGATTCGTCATGGGTAAGGCTATGTCAGATACTACCGCTCTGAAGGTCGCACAGGCTTTCGAGGAATGCGT
GTACCGAAGATTCGGTGCACCAACTCTAATCCGACATGACCGAGACCCCCGCTTCATGAGCGAGGTGTTCCAGGCCTTTGCAGAGATGATGCAATCTCGG
TCAAGAGCGACCCTGAGTTATCGGCCGCAGGCGAACGGACAGCAAGAGAGGTCGGTGAAGACGGTCATGCAATCGGTGCGGGTGTACGCAGAAGACCCGC
TGCAGCAAGACTGGGACGTGATCGCGGAGCGATTGATTTTCGCTATCAACAACTCTCAAGATGGCACCCGAAAG